PTEN phosphatase and tensin homolog

Canonical transcript: NM_000314

1229 unique variant annotations were identified in 1422 publications

Variant ID cDot pDot Consequence Exon Intron Reference Count
10-89623716-G-A c.-511G>A - 5-UTRSNV 1/9 - 4
10-89623716-G-C c.-511G>C - 5-UTRSNV 1/9 - 4
10-89623760-A-C c.-467A>C - 5-UTRSNV 1/9 - 1
10-89624103-G-A c.-124G>A - 5-UTRSNV 1/9 - 1
10-89624218-C-G c.-9C>G - 5-UTRSNV 1/9 - 3
10-89624227-CATGACAGCCATCATCAAAGAGATCGTTAGCAGAAACAAAAGGAGATATCAAGAGGATGG-C c.3_61del p.Met1_?21 Multi:SpliceDonorDeletion,SpliceAcceptorDeletion,CdsStartDeletion 1/9 - 2
10-89624229-G-T c.3G>T p.Met1? Missense 1/9 - 3
10-89624234-CCATCATCAAAGAGATCGTTAGCAGAAACAAAAGGAGATATCAAG-AGTAATGTTAGCGGTTAGGCGTACGGCCAGGGCTATTGGTTGAATGAGTAGGCTGATGGTTTCGAT c.8_52delinsAGTAATGTTAGCGGTTAGGCGTACGGCCAGGGCTATTGGTTGAATGAGTAGGCTGATGGTTTCGAT p.Ala3_Glu18delinsGlu* MultiAAMissense 1/9 - 1
10-89624235-C-G c.9C>G p.Ala3Ala Synonymous 1/9 - 2
10-89624241-C-CT c.15_16insT p.Lys6* Nonsense 1/9 - 1
10-89624242-A-G c.16A>G p.Lys6Glu Missense 1/9 - 3
10-89624242-A-T c.16A>T p.Lys6* Nonsense 1/9 - 1
10-89624243-AAAGAGA-A c.17_22del p.Lys6_Glu7del InFrameDeletion 1/9 - 1
10-89624243-A-T c.17A>T p.Lys6Ile Missense 1/9 - 2
10-89624243-AAA-A c.17_18del p.Lys6Argfs*4 Frameshift 1/9 - 4
10-89624244-A-G c.18A>G p.Lys6Lys Synonymous 1/9 - 1
10-89624245-G-T c.19G>T p.Glu7* Nonsense 1/9 - 3
10-89624245-AGAG-A c.19_21del p.Glu7del InFrameDeletion 1/9 - 1
10-89624247-AGA-A c.21_22del p.Glu7Aspfs*3 Frameshift 1/9 - 1
10-89624253-TT-T c.27del p.Ser10Alafs*14 Frameshift 1/9 - 1
10-89624254-AG-GC c.28_29delinsGC p.Ser10Ala Missense 1/9 - 88
10-89624254-AG-GA c.28_29delinsGA p.Ser10Asp Missense 1/9 - 17
10-89624254-AG-CC c.28_29delinsCC p.Ser10Pro Missense 1/9 - 1
10-89624254-AG-CA c.28_29delinsCA p.Ser10His Missense 1/9 - 1
10-89624254-AG-CT c.28_29inv p.Ser10Leu Missense 1/9 - 1
10-89624254-A-T c.28A>T p.Ser10Cys Missense 1/9 - 37
10-89624254-A-G c.28A>G p.Ser10Gly Missense 1/9 - 5
10-89624254-AGC-GAG c.28_30delinsGAG p.Ser10Glu Missense 1/9 - 15
10-89624254-AG-TT c.28_29delinsTT p.Ser10Phe Missense 1/9 - 4
10-89624255-GC-TG c.29_30delinsTG p.Ser10Met Missense 1/9 - 2
10-89624255-G-T c.29G>T p.Ser10Ile Missense 1/9 - 3
10-89624255-GC-AG c.29_30delinsAG p.Ser10Lys Missense 1/9 - 3
10-89624255-G-A c.29G>A p.Ser10Asn Missense 1/9 - 6
10-89624256-C-CT c.30_31insT p.Arg11* Nonsense 1/9 - 1
10-89624256-GCAG-G c.30_32del p.Ser10del InFrameDeletion 1/9 - 1
10-89624257-AG-GC c.31_32delinsGC p.Arg11Ala Missense 1/9 - 4
10-89624257-A-T c.31A>T p.Arg11* Nonsense 1/9 - 1
10-89624261-A-C c.35A>C p.Asn12Thr Missense 1/9 - 1
10-89624263-A-C c.37A>C p.Lys13Gln Missense 1/9 - 2
10-89624263-AAA-TAT c.37_39delinsTAT p.Lys13Tyr Missense 1/9 - 1
10-89624263-A-G c.37A>G p.Lys13Glu Missense 1/9 - 23
10-89624263-A-T c.37A>T p.Lys13* Nonsense 1/9 - 1
10-89624263-AA-GC c.37_38delinsGC p.Lys13Ala Missense 1/9 - 12
10-89624264-A-G c.38A>G p.Lys13Arg Missense 1/9 - 12
10-89624265-A-G c.39A>G p.Lys13Lys Synonymous 1/9 - 1
10-89624265-A-AT c.39_40insT p.Arg14* Nonsense 1/9 - 1
10-89624266-AG-GC c.40_41delinsGC p.Arg14Ala Missense 1/9 - 9
10-89624266-AGG-TTT c.40_42delinsTTT p.Arg14Phe Missense 1/9 - 1
10-89624266-A-G c.40A>G p.Arg14Gly Missense 1/9 - 3
10-89624268-G-A c.42G>A p.Arg14Arg Synonymous 1/9 - 1
10-89624268-G-C c.42G>C p.Arg14Ser Missense 1/9 - 3
10-89624268-G-T c.42G>T p.Arg14Ser Missense 1/9 - 3
10-89624266-A-C c.40A>C p.Arg14Arg Synonymous 1/9 - 1
10-89624269-AG-GC c.43_44delinsGC p.Arg15Ala Missense 1/9 - 9
10-89624269-GA-G c.43del p.Arg15Aspfs*9 Frameshift 1/9 - 2
10-89624269-AG-CA c.43_44delinsCA p.Arg15Gln Missense 1/9 - 1
10-89624269-A-G c.43A>G p.Arg15Gly Missense 1/9 - 2
10-89624270-G-A c.44G>A p.Arg15Lys Missense 1/9 - 4
10-89624271-A-T c.45A>T p.Arg15Ser Missense 1/9 - 9
10-89624271-A-C c.45A>C p.Arg15Ser Missense 1/9 - 9
10-89624272-TA-GC c.46_47delinsGC p.Tyr16Ala Missense 1/9 - 2
10-89624272-T-C c.46T>C p.Tyr16His Missense 1/9 - 1
10-89624272-T-TT c.46dup p.Tyr16Leufs*28 Frameshift 1/9 - 1
10-89624273-A-G c.47A>G p.Tyr16Cys Missense 1/9 - 3
10-89624274-T-A c.48T>A p.Tyr16* Nonsense 1/9 - 10
10-89624275-C-T c.49C>T p.Gln17* Nonsense 1/9 - 10
10-89624275-C-G c.49C>G p.Gln17Glu Missense 1/9 - 3
10-89624275-CA-GC c.49_50delinsGC p.Gln17Ala Missense 1/9 - 2
10-89624276-A-G c.50A>G p.Gln17Arg Missense 1/9 - 3
10-89624276-CAA-C c.50_51del p.Gln17Argfs*26 Frameshift 1/9 - 1
10-89624276-A-C c.50A>C p.Gln17Pro Missense 1/9 - 1
10-89624278-GAG-TGT c.52_54delinsTGT p.Glu18Cys Missense 1/9 - 1
10-89624281-G-T c.55G>T p.Asp19Tyr Missense 1/9 - 1
10-89624281-G-A c.55G>A p.Asp19Asn Missense 1/9 - 1
10-89624285-G-A c.59G>A p.Gly20Glu Missense 1/9 - 5
10-89624285-G-T c.59G>T p.Gly20Val Missense 1/9 - 3
10-89624287-TT-GC c.61_62delinsGC p.Phe21Ala Missense 1/9 - 4
10-89624291-A-G c.65A>G p.Asp22Gly Missense 1/9 - 1
10-89624291-A-C c.65A>C p.Asp22Ala Missense 1/9 - 2
10-89624292-C-G c.66C>G p.Asp22Glu Missense 1/9 - 7
10-89624293-TT-CC c.67_68delinsCC p.Leu23Pro Missense 1/9 - 1
10-89624293-TT-GC c.67_68delinsGC p.Leu23Ala Missense 1/9 - 4
10-89624294-T-A c.68T>A p.Leu23* Nonsense 1/9 - 1
10-89624294-T-TG c.68_69insG p.Asp24Argfs*20 Frameshift 1/9 - 1
10-89624295-A-C c.69A>C p.Leu23Phe Missense 1/9 - 4
10-89624295-A-AA c.69dup p.Asp24Argfs*20 Frameshift 1/9 - 1
10-89624296-G-C c.70G>C p.Asp24His Missense 1/9 - 4
10-89624296-G-T c.70G>T p.Asp24Tyr Missense 1/9 - 8
10-89624296-G-A c.70G>A p.Asp24Asn Missense 1/9 - 2
10-89624297-A-C c.71A>C p.Asp24Ala Missense 1/9 - 2
10-89624297-A-G c.71A>G p.Asp24Gly Missense 1/9 - 9
10-89624297-A-T c.71A>T p.Asp24Val Missense 1/9 - 2
10-89624298-C-A c.72C>A p.Asp24Glu Missense 1/9 - 1
10-89624298-C-CAGA c.72_73insAGA p.Asp24_Leu25insArg InFrameInsertion 1/9 - 1
10-89624298-C-G c.72C>G p.Asp24Glu Missense 1/9 - 1
10-89624299-TT-GC c.73_74delinsGC p.Leu25Ala Missense 1/9 - 2
10-89624299-CTT-C c.73_74del p.Leu25Aspfs*18 Frameshift 1/9 - 1
10-89624300-T-TT c.74dup p.Leu25Phefs*19 Frameshift 1/9 - 1
10-89624300-T-G c.74T>G p.Leu25Trp Missense 1/9 - 1
10-89624300-T-C c.74T>C p.Leu25Ser Missense 1/9 - 1
10-89624301-G-T c.75G>T p.Leu25Phe Missense 1/9 - 1
10-89624301-G-A c.75G>A p.Leu25Leu Synonymous 1/9 - 1
10-89624302-A-G c.76A>G p.Thr26Ala Missense 1/9 - 2
10-89624302-A-C c.76A>C p.Thr26Pro Missense 1/9 - 4
10-89624304-C-A c.78C>A p.Thr26Thr Synonymous 1/9 - 1
10-89624304-C-T c.78C>T p.Thr26Thr Synonymous 1/9 - 1
10-89624304-C-G c.78C>G p.Thr26Thr Synonymous 1/9 - 1
10-89624305-T-A c.79T>A p.Tyr27Asn Missense 1/9 - 3
10-89624305-T-G c.79T>G p.Tyr27Asp Missense 1/9 - 1
10-89624306-G-C c.79+1G>C - IntronicSNV - 1/8 1
10-89624312-A-G c.79+7A>G - IntronicSNV - 1/8 1
10-89624340-C-T c.79+35C>T - IntronicSNV - 1/8 1
10-89633231-C-T c.79+8926C>T - IntronicSNV - 1/8 1
10-89639962-G-A c.80-13820G>A - IntronicSNV - 1/8 3
10-89639962-G-T c.80-13820G>T - IntronicSNV - 1/8 3
10-89642609-A-G c.80-11173A>G - IntronicSNV - 1/8 2
10-89645473-A-G c.80-8309A>G - IntronicSNV - 1/8 4
10-89647154-G-A c.80-6628G>A - IntronicSNV - 1/8 1
10-89649577-A-G c.80-4205A>G - IntronicSNV - 1/8 4
10-89649838-G-A c.80-3944G>A - IntronicSNV - 1/8 1
10-89650759-C-T c.80-3023C>T - IntronicSNV - 1/8 2
10-89652826-TTTGACTCCCCAAAACTTAATATTTAGCCTATACTTGACTAGAAGTCTTACTGATGACAT-T c.80-956_80-898del - IntronicDeletion - 1/8 1
10-89653686-A-G c.80-96A>G - IntronicSNV - 1/8 15
10-89653781-G-C c.80-1G>C - IntronicSNV - 1/8 2
10-89653782-A-G c.80A>G p.Tyr27Cys Missense 2/9 - 8
10-89653782-A-C c.80A>C p.Tyr27Ser Missense 2/9 - 1
10-89653782-GATATTTATCCAAACATTATTGCTATGGGATTTCCTGCAGAAAGACTTGAAGGCGTATAC-G c.81_139del p.Tyr27* Unclassified 2/9 - 2
10-89653785-T-C c.83T>C p.Ile28Thr Missense 2/9 - 2
10-89653787-TA-GC c.85_86delinsGC p.Tyr29Ala Missense 2/9 - 2
10-89653788-A-G c.86A>G p.Tyr29Cys Missense 2/9 - 1
10-89653789-T-A c.87T>A p.Tyr29* Nonsense 2/9 - 2
10-89653794-A-G c.92A>G p.Asn31Ser Missense 2/9 - 1
10-89653797-T-A c.95T>A p.Ile32Asn Missense 2/9 - 1
10-89653799-ATT-TAA c.97_99delinsTAA p.Ile33* Nonsense 2/9 - 1
10-89653799-TATT-T c.97_99del p.Ile33del InFrameDeletion 2/9 - 2
10-89653800-T-G c.98T>G p.Ile33Ser Missense 2/9 - 2
10-89653802-G-A c.100G>A p.Ala34Thr Missense 2/9 - 1
10-89653802-GC-TG c.100_101delinsTG p.Ala34Cys Missense 2/9 - 1
10-89653802-GC-TT c.100_101delinsTT p.Ala34Phe Missense 2/9 - 1
10-89653803-C-A c.101C>A p.Ala34Asp Missense 2/9 - 6
10-89653805-A-G c.103A>G p.Met35Val Missense 2/9 - 5
10-89653805-AT-GC c.103_104delinsGC p.Met35Ala Missense 2/9 - 3
10-89653806-T-C c.104T>C p.Met35Thr Missense 2/9 - 2
10-89653807-G-T c.105G>T p.Met35Ile Missense 2/9 - 3
10-89653808-G-A c.106G>A p.Gly36Arg Missense 2/9 - 6
10-89653808-G-C c.106G>C p.Gly36Arg Missense 2/9 - 6
10-89653809-G-A c.107G>A p.Gly36Glu Missense 2/9 - 3
10-89653812-T-C c.110T>C p.Phe37Ser Missense 2/9 - 1
10-89653814-CCT-AAG c.112_114delinsAAG p.Pro38Lys Missense 2/9 - 1
10-89653814-C-T c.112C>T p.Pro38Ser Missense 2/9 - 6
10-89653814-C-G c.112C>G p.Pro38Ala Missense 2/9 - 7
10-89653814-CC-AT c.112_113delinsAT p.Pro38Ile Missense 2/9 - 2
10-89653815-C-A c.113C>A p.Pro38His Missense 2/9 - 5
10-89653817-G-A c.115G>A p.Ala39Thr Missense 2/9 - 1
10-89653820-G-A c.118G>A p.Glu40Lys Missense 2/9 - 9
10-89653823-A-G c.121A>G p.Arg41Gly Missense 2/9 - 3
10-89653823-AGA-GAC c.121_123delinsGAC p.Arg41Asp Missense 2/9 - 2
10-89653827-T-G c.125T>G p.Leu42Arg Missense 2/9 - 8
10-89653829-G-C c.127G>C p.Glu43Gln Missense 2/9 - 1
10-89653833-G-A c.131G>A p.Gly44Asp Missense 2/9 - 5
10-89653833-G-T c.131G>T p.Gly44Val Missense 2/9 - 1
10-89653834-C-T c.132C>T p.Gly44Gly Synonymous 2/9 - 4
10-89653835-GTA-TTT c.133_135delinsTTT p.Val45Phe Missense 2/9 - 1
10-89653835-GT-CA c.133_134delinsCA p.Val45Gln Missense 2/9 - 1
10-89653838-T-C c.136T>C p.Tyr46His Missense 2/9 - 2
10-89653838-TAC-CAA c.136_138delinsCAA p.Tyr46Gln Missense 2/9 - 1
10-89653839-A-G c.137A>G p.Tyr46Cys Missense 2/9 - 1
10-89653840-C-A c.138C>A p.Tyr46* Nonsense 2/9 - 1
10-89653841-AGG-GAC c.139_141delinsGAC p.Arg47Asp Missense 2/9 - 1
10-89653841-AGG-CAT c.139_141delinsCAT p.Arg47His Missense 2/9 - 1
10-89653841-A-G c.139A>G p.Arg47Gly Missense 2/9 - 3
10-89653841-AG-GC c.139_140delinsGC p.Arg47Ala Missense 2/9 - 3
10-89653841-A-T c.139A>T p.Arg47Trp Missense 2/9 - 3
10-89653841-AG-CT c.139_140inv p.Arg47Leu Missense 2/9 - 2
10-89653841-AG-TA c.139_140delinsTA p.Arg47* Nonsense 2/9 - 1
10-89653842-G-A c.140G>A p.Arg47Lys Missense 2/9 - 4
10-89653843-G-T c.141G>T p.Arg47Ser Missense 2/9 - 3
10-89653843-GG-G c.141del p.Asn48Thrfs*6 Frameshift 2/9 - 2
10-89653843-G-C c.141G>C p.Arg47Ser Missense 2/9 - 3
10-89653844-AAC-TAA c.142_144delinsTAA p.Asn48* Nonsense 2/9 - 1
10-89653845-A-T c.143A>T p.Asn48Ile Missense 2/9 - 1
10-89653845-AC-GG c.143_144delinsGG p.Asn48Arg Missense 2/9 - 1
10-89653845-AA-A c.143del p.Asn48Thrfs*6 Frameshift 2/9 - 1
10-89653846-C-G c.144C>G p.Asn48Lys Missense 2/9 - 4
10-89653846-C-A c.144C>A p.Asn48Lys Missense 2/9 - 4
10-89653848-A-G c.146A>G p.Asn49Ser Missense 2/9 - 1
10-89653848-A-T c.146A>T p.Asn49Ile Missense 2/9 - 1
10-89653848-AATATTGAT-A c.146_153del p.Asn49Argfs*11 Frameshift 2/9 - 1
10-89653850-AT-GC c.148_149delinsGC p.Ile50Ala Missense 2/9 - 1
10-89653851-T-C c.149T>C p.Ile50Thr Missense 2/9 - 3
10-89653852-TT-T c.150del p.Ile50Metfs*4 Frameshift 2/9 - 1
10-89653854-A-C c.152A>C p.Asp51Ala Missense 2/9 - 1
10-89653854-A-G c.152A>G p.Asp51Gly Missense 2/9 - 1
10-89653855-T-A c.153T>A p.Asp51Glu Missense 2/9 - 1
10-89653855-T-G c.153T>G p.Asp51Glu Missense 2/9 - 1
10-89653856-G-A c.154G>A p.Asp52Asn Missense 2/9 - 1
10-89653857-GATG-G c.155_157del p.Asp52del InFrameDeletion 2/9 - 1
10-89653857-A-C c.155A>C p.Asp52Ala Missense 2/9 - 2
10-89653858-T-G c.156T>G p.Asp52Glu Missense 2/9 - 2
10-89653858-T-A c.156T>A p.Asp52Glu Missense 2/9 - 2
10-89653861-A-ATACA c.159_160insTACA p.Val54Tyrfs*10 Frameshift 2/9 - 1
10-89653862-AGTA-A c.160_162del p.Val54del InFrameDeletion 2/9 - 1
10-89653862-G-A c.160G>A p.Val54Ile Missense 2/9 - 1
10-89653864-A-T c.162A>T p.Val54Val Synonymous 2/9 - 1
10-89653864-A-G c.162A>G p.Val54Val Synonymous 2/9 - 1
10-89653864-A-AT c.162_163insT p.Arg55* SpliceDonorInsertion 2/9 - 3
10-89653864-A-C c.162A>C p.Val54Val Synonymous 2/9 - 1
10-89653865-A-G c.163A>G p.Arg55Gly Missense 2/9 - 1
10-89653866-G-A c.164G>A p.Arg55Lys Missense 2/9 - 1
10-89653867-G-A c.164+1G>A - IntronicSNV - 2/8 2
10-89654089-T-C c.164+223T>C - IntronicSNV - 2/8 1
10-89655236-A-G c.164+1370A>G - IntronicSNV - 2/8 1
10-89655247-AA-AAAA c.164+1381_164+1382dup - IntronicInsertion - 2/8 1
10-89655248-A-AA c.164+1382dup - IntronicInsertion - 2/8 1
10-89657150-C-T c.164+3284C>T - IntronicSNV - 2/8 16
10-89657150-C-A c.164+3284C>A - IntronicSNV - 2/8 16
10-89665190-A-C c.164+11324A>C - IntronicSNV - 2/8 1
10-89665190-A-T c.164+11324A>T - IntronicSNV - 2/8 1
10-89665512-G-A c.164+11646G>A - IntronicSNV - 2/8 1
10-89673569-C-T c.165-11701C>T - IntronicSNV - 2/8 2
10-89674157-T-G c.165-11113T>G - IntronicSNV - 2/8 8
10-89675296-A-G c.165-9974A>G - IntronicSNV - 2/8 7
10-89675590-G-C c.165-9680G>C - IntronicSNV - 2/8 2
10-89677107-A-T c.165-8163A>T - IntronicSNV - 2/8 2
10-89677107-A-G c.165-8163A>G - IntronicSNV - 2/8 2
10-89677387-T-C c.165-7883T>C - IntronicSNV - 2/8 1
10-89678296-A-G c.165-6974A>G - IntronicSNV - 2/8 1
10-89682833-G-T c.165-2437G>T - IntronicSNV - 2/8 1
10-89682833-G-C c.165-2437G>C - IntronicSNV - 2/8 1
10-89682833-G-A c.165-2437G>A - IntronicSNV - 2/8 1
10-89685257-TGTTT-T c.165-13_165-10del - IntronicDeletion - 2/8 1
10-89685268-A-G c.165-2A>G - IntronicSNV - 2/8 1
10-89685269-G-A c.165-1G>A - IntronicSNV - 2/8 1
10-89685270-G-GG c.165dup p.Phe56Valfs*7 SpliceAcceptorInsertion 3/9 - 2
10-89685270-G-C c.165G>C p.Arg55Ser Missense 3/9 - 1
10-89685270-GGTTTTTGGATTCAAAGCATAAAAACCATTACAAGATATACAATCTGTAAGTATGTTTTC-G c.165_209+14del - Multi:SpliceAcceptorDeletion,CdsStopDeletion 3/9 3/8 2
10-89685270-G-T c.165G>T p.Arg55Ser Missense 3/9 - 1
10-89685271-T-G c.166T>G p.Phe56Val Missense 3/9 - 2
10-89685273-T-G c.168T>G p.Phe56Leu Missense 3/9 - 1
10-89685273-T-A c.168T>A p.Phe56Leu Missense 3/9 - 1
10-89685271-T-A c.166T>A p.Phe56Ile Missense 3/9 - 1
10-89685271-T-C c.166T>C p.Phe56Leu Missense 3/9 - 1
10-89685272-TT-AA c.167_168inv p.Phe56* Nonsense 3/9 - 1
10-89685274-TTG-AAC c.169_171delinsAAC p.Leu57Asn Missense 3/9 - 1
10-89685275-T-C c.170T>C p.Leu57Ser Missense 3/9 - 3
10-89685275-T-G c.170T>G p.Leu57Trp Missense 3/9 - 1
10-89685275-T-TT c.170dup p.Leu57Phefs*6 Frameshift 3/9 - 1
10-89685278-A-C c.173A>C p.Asp58Ala Missense 3/9 - 1
10-89685280-TC-GA c.175_176inv p.Ser59Glu Missense 3/9 - 1
10-89685281-C-A c.176C>A p.Ser59* Nonsense 3/9 - 5
10-89685281-C-G c.176C>G p.Ser59* Nonsense 3/9 - 4
10-89685282-A-G c.177A>G p.Ser59Ser Synonymous 3/9 - 1
10-89685283-AA-GC c.178_179delinsGC p.Lys60Ala Missense 3/9 - 1
10-89685284-A-G c.179A>G p.Lys60Arg Missense 3/9 - 2
10-89685285-G-T c.180G>T p.Lys60Asn Missense 3/9 - 1
10-89685286-CA-GC c.181_182delinsGC p.His61Ala Missense 3/9 - 1
10-89685286-C-T c.181C>T p.His61Tyr Missense 3/9 - 1
10-89685286-C-G c.181C>G p.His61Asp Missense 3/9 - 2
10-89685287-A-G c.182A>G p.His61Arg Missense 3/9 - 7
10-89685288-T-G c.183T>G p.His61Gln Missense 3/9 - 2
10-89685288-T-A c.183T>A p.His61Gln Missense 3/9 - 2
10-89685289-AA-GC c.184_185delinsGC p.Lys62Ala Missense 3/9 - 1
10-89685289-A-T c.184A>T p.Lys62* Nonsense 3/9 - 1
10-89685290-A-G c.185A>G p.Lys62Arg Missense 3/9 - 6
10-89685291-A-T c.186A>T p.Lys62Asn Missense 3/9 - 1
10-89685291-A-C c.186A>C p.Lys62Asn Missense 3/9 - 1
10-89685292-AA-GC c.187_188delinsGC p.Asn63Ala Missense 3/9 - 1
10-89685299-A-G c.194A>G p.Tyr65Cys Missense 3/9 - 7
10-89685300-C-A c.195C>A p.Tyr65* Nonsense 3/9 - 2
10-89685301-A-G c.196A>G p.Lys66Glu Missense 3/9 - 2
10-89685302-A-G c.197A>G p.Lys66Arg Missense 3/9 - 2
10-89685303-G-A c.198G>A p.Lys66Lys Synonymous 3/9 - 1
10-89685305-T-G c.200T>G p.Ile67Arg Missense 3/9 - 1
10-89685306-A-C c.201A>C p.Ile67Ile Synonymous 3/9 - 3
10-89685306-A-T c.201A>T p.Ile67Ile Synonymous 3/9 - 3
10-89685306-A-G c.201A>G p.Ile67Met Missense 3/9 - 1
10-89685307-TA-CG c.202_203delinsCG p.Tyr68Arg Missense 3/9 - 1
10-89685307-T-G c.202T>G p.Tyr68Asp Missense 3/9 - 1
10-89685307-T-C c.202T>C p.Tyr68His Missense 3/9 - 13
10-89685307-T-A c.202T>A p.Tyr68Asn Missense 3/9 - 2
10-89685308-A-G c.203A>G p.Tyr68Cys Missense 3/9 - 6
10-89685308-A-T c.203A>T p.Tyr68Phe Missense 3/9 - 2
10-89685309-C-G c.204C>G p.Tyr68* Nonsense 3/9 - 2
10-89685309-C-A c.204C>A p.Tyr68* Nonsense 3/9 - 2
10-89685310-A-G c.205A>G p.Asn69Asp Missense 3/9 - 2
10-89685310-AA-GC c.205_206delinsGC p.Asn69Ala Missense 3/9 - 1
10-89685313-C-A c.208C>A p.Leu70Ile Missense 3/9 - 1
10-89685313-CT-GC c.208_209delinsGC p.Leu70Ala Missense 3/9 - 1
10-89685313-C-G c.208C>G p.Leu70Val Missense 3/9 - 6
10-89685313-TCTG-T c.208_209+1del - SpliceDonorDeletion 3/9 3/8 1
10-89685314-T-C c.209T>C p.Leu70Pro Missense 3/9 - 2
10-89685315-G-C c.209+1G>C - IntronicSNV - 3/8 1
10-89685315-TG-T c.209+1del - IntronicDeletion - 3/8 1
10-89685317-A-T c.209+3A>T - IntronicSNV - 3/8 1
10-89685318-AAGTA-A c.209+4_209+7del - IntronicDeletion - 3/8 3
10-89685319-G-A c.209+5G>A - IntronicSNV - 3/8 4
10-89685643-T-C c.209+329T>C - IntronicSNV - 3/8 6
10-89686509-G-T c.209+1195G>T - IntronicSNV - 3/8 3
10-89689321-G-A c.210-1482G>A - IntronicSNV - 3/8 4
10-89690789-A-G c.210-14A>G - IntronicSNV - 3/8 1
10-89690796-TCTTTT-T c.210-7_210-3del - IntronicDeletion - 3/8 1
10-89690801-TAGTT-T c.210-2_211del - SpliceAcceptorDeletion 4/9 3/8 1
10-89690801-A-G c.210-2A>G - IntronicSNV - 3/8 1
10-89690802-G-A c.210-1G>A - IntronicSNV - 3/8 1
10-89690804-TG-GC c.211_212delinsGC p.Cys71Ala Missense 4/9 - 3
10-89690804-T-G c.211T>G p.Cys71Gly Missense 4/9 - 1
10-89690805-G-C c.212G>C p.Cys71Ser Missense 4/9 - 5
10-89690804-T-A c.211T>A p.Cys71Ser Missense 4/9 - 5
10-89690804-TT-T c.211del p.Cys71Valfs*28 Frameshift 4/9 - 1
10-89690805-G-T c.212G>T p.Cys71Phe Missense 4/9 - 1
10-89690805-G-A c.212G>A p.Cys71Tyr Missense 4/9 - 1
10-89690806-T-G c.213T>G p.Cys71Trp Missense 4/9 - 1
10-89690808-C-G c.215C>G p.Ala72Gly Missense 4/9 - 1
10-89690808-C-A c.215C>A p.Ala72Asp Missense 4/9 - 1
10-89690810-GA-AG c.217_218delinsAG p.Glu73Arg Missense 4/9 - 1
10-89690810-GA-AT c.217_218delinsAT p.Glu73Ile Missense 4/9 - 1
10-89690810-G-C c.217G>C p.Glu73Gln Missense 4/9 - 1
10-89690810-G-T c.217G>T p.Glu73* Nonsense 4/9 - 1
10-89690811-A-C c.218A>C p.Glu73Ala Missense 4/9 - 1
10-89690812-A-T c.219A>T p.Glu73Asp Missense 4/9 - 3
10-89690812-A-C c.219A>C p.Glu73Asp Missense 4/9 - 3
10-89690813-A-T c.220A>T p.Arg74* Nonsense 4/9 - 1
10-89690813-AA-A c.220del p.Arg74Aspfs*25 Frameshift 4/9 - 1
10-89690813-AGA-GAC c.220_222delinsGAC p.Arg74Asp Missense 4/9 - 2
10-89690813-AG-GA c.220_221delinsGA p.Arg74Glu Missense 4/9 - 1
10-89690813-AG-GC c.220_221delinsGC p.Arg74Ala Missense 4/9 - 1
10-89690813-AGA-TGT c.220_222delinsTGT p.Arg74Cys Missense 4/9 - 1
10-89690814-G-T c.221G>T p.Arg74Ile Missense 4/9 - 1
10-89690814-AGACATTA-A c.221_227del p.Arg74Metfs*23 Frameshift 4/9 - 1
10-89690816-ACA-A c.223_224del p.His75Leufs*2 Frameshift 4/9 - 1
10-89690819-TTAT-T c.226_228del p.Tyr76del InFrameDeletion 4/9 - 1
10-89690821-T-G c.228T>G p.Tyr76* Nonsense 4/9 - 3
10-89690821-T-A c.228T>A p.Tyr76* Nonsense 4/9 - 3
10-89690823-A-T c.230A>T p.Asp77Val Missense 4/9 - 1
10-89690825-A-G c.232A>G p.Thr78Ala Missense 4/9 - 4
10-89690827-C-T c.234C>T p.Thr78Thr Synonymous 4/9 - 3
10-89690828-G-T c.235G>T p.Ala79Ser Missense 4/9 - 1
10-89690828-G-A c.235G>A p.Ala79Thr Missense 4/9 - 11
10-89690829-C-A c.236C>A p.Ala79Asp Missense 4/9 - 1
10-89690829-C-T c.236C>T p.Ala79Val Missense 4/9 - 1
10-89690829-CC-AG c.236_237delinsAG p.Ala79Glu Missense 4/9 - 1
10-89690831-AA-GC c.238_239delinsGC p.Lys80Ala Missense 4/9 - 1
10-89690831-A-T c.238A>T p.Lys80* Nonsense 4/9 - 1
10-89690831-A-G c.238A>G p.Lys80Glu Missense 4/9 - 1
10-89690832-A-G c.239A>G p.Lys80Arg Missense 4/9 - 3
10-89690833-A-G c.240A>G p.Lys80Lys Synonymous 4/9 - 1
10-89690838-A-C c.245A>C p.Asn82Thr Missense 4/9 - 1
10-89690838-AT-GG c.245_246delinsGG p.Asn82Arg Missense 4/9 - 1
10-89690838-A-AA c.245dup p.Asn82Lysfs*10 Frameshift 4/9 - 1
10-89690840-TG-GC c.247_248delinsGC p.Cys83Ala Missense 4/9 - 3
10-89690841-G-C c.248G>C p.Cys83Ser Missense 4/9 - 7
10-89690840-T-A c.247T>A p.Cys83Ser Missense 4/9 - 7
10-89690841-G-T c.248G>T p.Cys83Phe Missense 4/9 - 1
10-89690842-C-A c.249C>A p.Cys83* Nonsense 4/9 - 3
10-89690843-A-G c.250A>G p.Arg84Gly Missense 4/9 - 1
10-89690844-G-A c.251G>A p.Arg84Lys Missense 4/9 - 1
10-89690845-A-G c.252A>G p.Arg84Arg Synonymous 4/9 - 1
10-89690846-G-T c.253G>T p.Val85Phe Missense 4/9 - 2
10-89690847-G-A c.253+1G>A - IntronicSNV - 4/8 1
10-89690847-G-T c.253+1G>T - IntronicSNV - 4/8 4
10-89690851-G-T c.253+5G>T - IntronicSNV - 4/8 2
10-89690851-G-A c.253+5G>A - IntronicSNV - 4/8 1
10-89690955-A-ATCTT c.253+109_253+110insTCTT - IntronicInsertion - 4/8 1
10-89692770-GTT-G c.254_255del p.Val85Glyfs*6 SpliceAcceptorDeletion 5/9 - 1
10-89692772-G-C c.256G>C p.Ala86Pro Missense 5/9 - 1
10-89692773-C-A c.257C>A p.Ala86Glu Missense 5/9 - 2
10-89692775-C-T c.259C>T p.Gln87* Nonsense 5/9 - 8
10-89692776-A-C c.260A>C p.Gln87Pro Missense 5/9 - 2
10-89692778-T-C c.262T>C p.Tyr88His Missense 5/9 - 2
10-89692779-A-G c.263A>G p.Tyr88Cys Missense 5/9 - 6
10-89692780-T-A c.264T>A p.Tyr88* Nonsense 5/9 - 1
10-89692780-T-G c.264T>G p.Tyr88* Nonsense 5/9 - 1
10-89692781-C-A c.265C>A p.Pro89Thr Missense 5/9 - 1
10-89692782-C-G c.266C>G p.Pro89Arg Missense 5/9 - 1
10-89692784-T-C c.268T>C p.Phe90Leu Missense 5/9 - 1
10-89692786-T-G c.270T>G p.Phe90Leu Missense 5/9 - 1
10-89692786-T-A c.270T>A p.Phe90Leu Missense 5/9 - 1
10-89692785-T-C c.269T>C p.Phe90Ser Missense 5/9 - 5
10-89692786-TT-T c.270del p.Phe90Leufs*9 Frameshift 5/9 - 2
10-89692787-GA-AG c.271_272delinsAG p.Glu91Arg Missense 5/9 - 2
10-89692787-GA-TT c.271_272delinsTT p.Glu91Leu Missense 5/9 - 1
10-89692787-G-C c.271G>C p.Glu91Gln Missense 5/9 - 3
10-89692790-GA-TT c.274_275delinsTT p.Asp92Phe Missense 5/9 - 1
10-89692790-G-C c.274G>C p.Asp92His Missense 5/9 - 5
10-89692790-G-T c.274G>T p.Asp92Tyr Missense 5/9 - 1
10-89692791-A-C c.275A>C p.Asp92Ala Missense 5/9 - 9
10-89692791-A-G c.275A>G p.Asp92Gly Missense 5/9 - 4
10-89692792-C-G c.276C>G p.Asp92Glu Missense 5/9 - 11
10-89692792-C-A c.276C>A p.Asp92Glu Missense 5/9 - 11
10-89692793-C-G c.277C>G p.His93Asp Missense 5/9 - 2
10-89692793-C-T c.277C>T p.His93Tyr Missense 5/9 - 6
10-89692793-CA-GC c.277_278delinsGC p.His93Ala Missense 5/9 - 5
10-89692794-A-G c.278A>G p.His93Arg Missense 5/9 - 23
10-89692795-T-G c.279T>G p.His93Gln Missense 5/9 - 2
10-89692795-T-A c.279T>A p.His93Gln Missense 5/9 - 2
10-89692799-C-A c.283C>A p.Pro95Thr Missense 5/9 - 1
10-89692799-C-T c.283C>T p.Pro95Ser Missense 5/9 - 6
10-89692800-C-T c.284C>T p.Pro95Leu Missense 5/9 - 4
10-89692800-C-G c.284C>G p.Pro95Arg Missense 5/9 - 1
10-89692802-C-T c.286C>T p.Pro96Ser Missense 5/9 - 2
10-89692803-C-T c.287C>T p.Pro96Leu Missense 5/9 - 1
10-89692803-C-A c.287C>A p.Pro96Gln Missense 5/9 - 1
10-89692803-C-G c.287C>G p.Pro96Arg Missense 5/9 - 3
10-89692805-C-T c.289C>T p.Gln97* Nonsense 5/9 - 2
10-89692806-A-G c.290A>G p.Gln97Arg Missense 5/9 - 1
10-89692807-G-T c.291G>T p.Gln97His Missense 5/9 - 1
10-89692807-G-C c.291G>C p.Gln97His Missense 5/9 - 1
10-89692808-C-T c.292C>T p.Leu98Leu Synonymous 5/9 - 2
10-89692811-G-A c.295G>A p.Glu99Lys Missense 5/9 - 3
10-89692813-A-T c.297A>T p.Glu99Asp Missense 5/9 - 1
10-89692813-A-C c.297A>C p.Glu99Asp Missense 5/9 - 1
10-89692813-A-AA c.297dup p.Leu100Thrfs*7 Frameshift 5/9 - 1
10-89692814-CT-GC c.298_299delinsGC p.Leu100Ala Missense 5/9 - 1
10-89692817-A-AA c.301dup p.Ile101Asnfs*6 Frameshift 5/9 - 1
10-89692817-AT-GC c.301_302delinsGC p.Ile101Ala Missense 5/9 - 1
10-89692818-T-C c.302T>C p.Ile101Thr Missense 5/9 - 10
10-89692822-A-AAAG c.306_307insAAG p.Lys102dup InFrameInsertion 5/9 - 1
10-89692824-CC-AA c.308_309delinsAA p.Pro103Gln Missense 5/9 - 1
10-89692826-T-C c.310T>C p.Phe104Leu Missense 5/9 - 2
10-89692829-TG-GC c.313_314delinsGC p.Cys105Ala Missense 5/9 - 2
10-89692829-T-G c.313T>G p.Cys105Gly Missense 5/9 - 1
10-89692830-G-T c.314G>T p.Cys105Phe Missense 5/9 - 3
10-89692830-G-A c.314G>A p.Cys105Tyr Missense 5/9 - 3
10-89692832-G-T c.316G>T p.Glu106* Nonsense 5/9 - 1
10-89692832-G-C c.316G>C p.Glu106Gln Missense 5/9 - 1
10-89692835-G-T c.319G>T p.Asp107Tyr Missense 5/9 - 3
10-89692836-A-G c.320A>G p.Asp107Gly Missense 5/9 - 3
10-89692836-A-C c.320A>C p.Asp107Ala Missense 5/9 - 1
10-89692839-T-G c.323T>G p.Leu108Arg Missense 5/9 - 9
10-89692839-T-C c.323T>C p.Leu108Pro Missense 5/9 - 8
10-89692840-TT-T c.324del p.Asp109Thrfs*4 Frameshift 5/9 - 1
10-89692841-GAC-TAA c.325_327delinsTAA p.Asp109* Nonsense 5/9 - 1
10-89692844-C-G c.328C>G p.Gln110Glu Missense 5/9 - 1
10-89692844-C-T c.328C>T p.Gln110* Nonsense 5/9 - 6
10-89692845-A-G c.329A>G p.Gln110Arg Missense 5/9 - 1
10-89692847-T-A c.331T>A p.Trp111Arg Missense 5/9 - 2
10-89692847-T-C c.331T>C p.Trp111Arg Missense 5/9 - 2
10-89692847-TGG-CAT c.331_333delinsCAT p.Trp111His Missense 5/9 - 2
10-89692848-G-A c.332G>A p.Trp111* Nonsense 5/9 - 3
10-89692849-G-A c.333G>A p.Trp111* Nonsense 5/9 - 3
10-89692849-G-T c.333G>T p.Trp111Cys Missense 5/9 - 1
10-89692849-G-C c.333G>C p.Trp111Cys Missense 5/9 - 1
10-89692850-GCTAAGTGAAGATGACAATCATGTTGCAGCAATTCACTGTAAAGCTGGAAAGGGACGAAC-G c.334_392del p.Leu112Trpfs*48 InFrameDeletion 5/9 - 1
10-89692850-C-G c.334C>G p.Leu112Val Missense 5/9 - 4
10-89692851-T-A c.335T>A p.Leu112Gln Missense 5/9 - 1
10-89692851-T-G c.335T>G p.Leu112Arg Missense 5/9 - 3
10-89692851-T-C c.335T>C p.Leu112Pro Missense 5/9 - 3
10-89692853-AGT-GAG c.337_339delinsGAG p.Ser113Glu Missense 5/9 - 1
10-89692853-AG-GC c.337_338delinsGC p.Ser113Ala Missense 5/9 - 2
10-89692858-A-C c.342A>C p.Glu114Asp Missense 5/9 - 1
10-89692858-A-T c.342A>T p.Glu114Asp Missense 5/9 - 1
10-89692859-G-A c.343G>A p.Asp115Asn Missense 5/9 - 3
10-89692866-A-G c.350A>G p.Asn117Ser Missense 5/9 - 2
10-89692868-C-A c.352C>A p.His118Asn Missense 5/9 - 1
10-89692868-C-T c.352C>T p.His118Tyr Missense 5/9 - 1
10-89692869-A-C c.353A>C p.His118Pro Missense 5/9 - 3
10-89692871-G-T c.355G>T p.Val119Phe Missense 5/9 - 1
10-89692871-G-C c.355G>C p.Val119Leu Missense 5/9 - 2
10-89692871-TG-T c.355del p.Val119Leufs*15 Frameshift 5/9 - 1
10-89692872-T-A c.356T>A p.Val119Asp Missense 5/9 - 1
10-89692872-T-C c.356T>C p.Val119Ala Missense 5/9 - 1
10-89692874-G-C c.358G>C p.Ala120Pro Missense 5/9 - 2
10-89692875-C-A c.359C>A p.Ala120Glu Missense 5/9 - 1
10-89692876-A-C c.360A>C p.Ala120Ala Synonymous 5/9 - 1
10-89692876-A-T c.360A>T p.Ala120Ala Synonymous 5/9 - 1
10-89692876-A-G c.360A>G p.Ala120Ala Synonymous 5/9 - 1
10-89692877-G-A c.361G>A p.Ala121Thr Missense 5/9 - 1
10-89692878-C-T c.362C>T p.Ala121Val Missense 5/9 - 1
10-89692878-C-A c.362C>A p.Ala121Glu Missense 5/9 - 1
10-89692880-A-G c.364A>G p.Ile122Val Missense 5/9 - 1
10-89692881-T-A c.365T>A p.Ile122Asn Missense 5/9 - 2
10-89692881-T-G c.365T>G p.Ile122Ser Missense 5/9 - 2
10-89692883-C-T c.367C>T p.His123Tyr Missense 5/9 - 5
10-89692883-C-G c.367C>G p.His123Asp Missense 5/9 - 1
10-89692884-A-C c.368A>C p.His123Pro Missense 5/9 - 1
10-89692884-A-G c.368A>G p.His123Arg Missense 5/9 - 1
10-89692885-C-G c.369C>G p.His123Gln Missense 5/9 - 3
10-89692886-TG-AC c.370_371delinsAC p.Cys124Thr Missense 5/9 - 1
10-89692886-TG-GC c.370_371delinsGC p.Cys124Ala Missense 5/9 - 12
10-89692886-T-G c.370T>G p.Cys124Gly Missense 5/9 - 1
10-89692886-T-C c.370T>C p.Cys124Arg Missense 5/9 - 12
10-89692887-G-C c.371G>C p.Cys124Ser Missense 5/9 - 248
10-89692887-G-A c.371G>A p.Cys124Tyr Missense 5/9 - 3
10-89692887-G-T c.371G>T p.Cys124Phe Missense 5/9 - 2
10-89692888-T-G c.372T>G p.Cys124Trp Missense 5/9 - 1
10-89692888-T-C c.372T>C p.Cys124Cys Synonymous 5/9 - 1
10-89692889-AA-CT c.373_374delinsCT p.Lys125Leu Missense 5/9 - 1
10-89692889-A-G c.373A>G p.Lys125Glu Missense 5/9 - 4
10-89692890-A-G c.374A>G p.Lys125Arg Missense 5/9 - 2
10-89692891-A-C c.375A>C p.Lys125Asn Missense 5/9 - 1
10-89692891-A-T c.375A>T p.Lys125Asn Missense 5/9 - 1
10-89692892-G-A c.376G>A p.Ala126Thr Missense 5/9 - 4
10-89692892-G-T c.376G>T p.Ala126Ser Missense 5/9 - 4
10-89692892-G-C c.376G>C p.Ala126Pro Missense 5/9 - 4
10-89692893-C-T c.377C>T p.Ala126Val Missense 5/9 - 4
10-89692893-C-G c.377C>G p.Ala126Gly Missense 5/9 - 6
10-89692895-G-C c.379G>C p.Gly127Arg Missense 5/9 - 4
10-89692895-G-A c.379G>A p.Gly127Arg Missense 5/9 - 4
10-89692896-G-T c.380G>T p.Gly127Val Missense 5/9 - 2
10-89692896-G-A c.380G>A p.Gly127Glu Missense 5/9 - 1
10-89692898-A-G c.382A>G p.Lys128Glu Missense 5/9 - 1
10-89692898-A-C c.382A>C p.Lys128Gln Missense 5/9 - 1
10-89692899-AAGGGACGAA-A c.383_391del p.Lys128_Arg130del InFrameDeletion 5/9 - 2
10-89692899-A-C c.383A>C p.Lys128Thr Missense 5/9 - 2
10-89692899-A-G c.383A>G p.Lys128Arg Missense 5/9 - 1
10-89692900-G-C c.384G>C p.Lys128Asn Missense 5/9 - 3
10-89692900-G-T c.384G>T p.Lys128Asn Missense 5/9 - 3
10-89692901-GGA-AGC c.385_387delinsAGC p.Gly129Ser Missense 5/9 - 1
10-89692901-GGA-TGT c.385_387delinsTGT p.Gly129Cys Missense 5/9 - 1
10-89692901-G-T c.385G>T p.Gly129* Nonsense 5/9 - 5
10-89692901-G-C c.385G>C p.Gly129Arg Missense 5/9 - 57
10-89692901-GG-CA c.385_386delinsCA p.Gly129Gln Missense 5/9 - 1
10-89692901-G-A c.385G>A p.Gly129Arg Missense 5/9 - 57
10-89692902-G-A c.386G>A p.Gly129Glu Missense 5/9 - 172
10-89692902-G-T c.386G>T p.Gly129Val Missense 5/9 - 5
10-89692902-G-C c.386G>C p.Gly129Ala Missense 5/9 - 1
10-89692904-ACGA-A c.388_390del p.Arg130del InFrameDeletion 5/9 - 2
10-89692904-C-G c.388C>G p.Arg130Gly Missense 5/9 - 54
10-89692904-CGA-ATG c.388_390delinsATG p.Arg130Met Missense 5/9 - 1
10-89692904-C-T c.388C>T p.Arg130* Nonsense 5/9 - 84
10-89692905-CG-C c.389del p.Arg130Glnfs*4 Frameshift 5/9 - 4
10-89692905-G-T c.389G>T p.Arg130Leu Missense 5/9 - 14
10-89692905-G-A c.389G>A p.Arg130Gln Missense 5/9 - 70
10-89692905-G-C c.389G>C p.Arg130Pro Missense 5/9 - 8
10-89692907-A-C c.391A>C p.Thr131Pro Missense 5/9 - 1
10-89692908-C-A c.392C>A p.Thr131Asn Missense 5/9 - 2
10-89692908-C-T c.392C>T p.Thr131Ile Missense 5/9 - 4
10-89692910-G-T c.394G>T p.Gly132Cys Missense 5/9 - 1
10-89692910-G-A c.394G>A p.Gly132Ser Missense 5/9 - 2
10-89692910-GG-TT c.394_395delinsTT p.Gly132Phe Missense 5/9 - 1
10-89692911-G-A c.395G>A p.Gly132Asp Missense 5/9 - 10
10-89692911-G-T c.395G>T p.Gly132Val Missense 5/9 - 3
10-89692911-G-C c.395G>C p.Gly132Ala Missense 5/9 - 1
10-89692913-G-A c.397G>A p.Val133Ile Missense 5/9 - 2
10-89692916-A-T c.400A>T p.Met134Leu Missense 5/9 - 3
10-89692917-T-C c.401T>C p.Met134Thr Missense 5/9 - 1
10-89692917-T-G c.401T>G p.Met134Arg Missense 5/9 - 3
10-89692918-G-C c.402G>C p.Met134Ile Missense 5/9 - 6
10-89692918-G-A c.402G>A p.Met134Ile Missense 5/9 - 6
10-89692918-G-T c.402G>T p.Met134Ile Missense 5/9 - 6
10-89692918-TGAT-T c.402_404del p.Met134del InFrameDeletion 5/9 - 3
10-89692919-A-G c.403A>G p.Ile135Val Missense 5/9 - 3
10-89692920-T-A c.404T>A p.Ile135Lys Missense 5/9 - 2
10-89692921-A-AA c.405dup p.Cys136Metfs*44 Frameshift 5/9 - 4
10-89692922-TG-GC c.406_407delinsGC p.Cys136Ala Missense 5/9 - 1
10-89692922-T-C c.406T>C p.Cys136Arg Missense 5/9 - 16
10-89692922-T-G c.406T>G p.Cys136Gly Missense 5/9 - 1
10-89692922-AT-A c.406del p.Cys136Valfs*11 Frameshift 5/9 - 1
10-89692923-G-A c.407G>A p.Cys136Tyr Missense 5/9 - 10
10-89692924-T-G c.408T>G p.Cys136Trp Missense 5/9 - 1
10-89692925-GCA-TTT c.409_411delinsTTT p.Ala137Phe Missense 5/9 - 1
10-89692928-TA-CT c.412_413delinsCT p.Tyr138Leu Missense 5/9 - 25
10-89692929-A-G c.413A>G p.Tyr138Cys Missense 5/9 - 6
10-89692929-A-T c.413A>T p.Tyr138Phe Missense 5/9 - 2
10-89692931-T-G c.415T>G p.Leu139Val Missense 5/9 - 1
10-89692932-T-G c.416T>G p.Leu139* Nonsense 5/9 - 9
10-89692932-T-A c.416T>A p.Leu139* Nonsense 5/9 - 9
10-89692932-TT-T c.416del p.Leu139Tyrfs*8 Frameshift 5/9 - 1
10-89692933-A-C c.417A>C p.Leu139Phe Missense 5/9 - 1
10-89692933-A-T c.417A>T p.Leu139Phe Missense 5/9 - 1
10-89692935-T-A c.419T>A p.Leu140* Nonsense 5/9 - 1
10-89692935-T-G c.419T>G p.Leu140* Nonsense 5/9 - 1
10-89692936-A-T c.420A>T p.Leu140Phe Missense 5/9 - 1
10-89692936-A-C c.420A>C p.Leu140Phe Missense 5/9 - 1
10-89692936-A-AA c.420dup p.His141Thrfs*39 Frameshift 5/9 - 4
10-89692937-C-T c.421C>T p.His141Tyr Missense 5/9 - 1
10-89692937-C-G c.421C>G p.His141Asp Missense 5/9 - 1
10-89692938-A-G c.422A>G p.His141Arg Missense 5/9 - 2
10-89692940-CGGGGCAAATTTTTA-CAAGGTAAGTTTTAA c.425_437delinsAAGGTAAGTTTTA p.Arg142_Leu146delinsGlnGlyLysPhe* MultiAAMissense 5/9 - 1
10-89692940-C-T c.424C>T p.Arg142Trp Missense 5/9 - 1
10-89692941-G-A c.425G>A p.Arg142Gln Missense 5/9 - 3
10-89692941-CGGGGCAAATTTTT-C c.425_437del p.Arg142Glnfs*7 Frameshift 5/9 - 1
10-89692943-GG-CA c.427_428delinsCA p.Gly143His Missense 5/9 - 1
10-89692944-GG-G c.428del p.Gly143Alafs*4 Frameshift 5/9 - 1
10-89692946-A-T c.430A>T p.Lys144* Nonsense 5/9 - 1
10-89692946-A-C c.430A>C p.Lys144Gln Missense 5/9 - 1
10-89692946-AAA-TAT c.430_432delinsTAT p.Lys144Tyr Missense 5/9 - 1
10-89692947-A-G c.431A>G p.Lys144Arg Missense 5/9 - 1
10-89692948-A-C c.432A>C p.Lys144Asn Missense 5/9 - 1
10-89692948-A-T c.432A>T p.Lys144Asn Missense 5/9 - 1
10-89692949-T-A c.433T>A p.Phe145Ile Missense 5/9 - 1
10-89692949-T-G c.433T>G p.Phe145Val Missense 5/9 - 1
10-89692953-T-A c.437T>A p.Leu146* Nonsense 5/9 - 3
10-89692953-T-G c.437T>G p.Leu146* Nonsense 5/9 - 3
10-89692956-A-G c.440A>G p.Lys147Arg Missense 5/9 - 1
10-89692956-A-AA c.440dup p.Ala148Glyfs*32 Frameshift 5/9 - 1
10-89692958-G-A c.442G>A p.Ala148Thr Missense 5/9 - 1
10-89692959-C-A c.443C>A p.Ala148Glu Missense 5/9 - 1
10-89692961-C-A c.445C>A p.Gln149Lys Missense 5/9 - 1
10-89692961-C-T c.445C>T p.Gln149* Nonsense 5/9 - 7
10-89692964-G-T c.448G>T p.Glu150* Nonsense 5/9 - 1
10-89692970-CTA-TTT c.454_456delinsTTT p.Leu152Phe Missense 5/9 - 1
10-89692971-T-C c.455T>C p.Leu152Pro Missense 5/9 - 4
10-89692972-TAGATTTCTATGGG-T c.456_468del p.Asp153Lysfs*2 Frameshift 5/9 - 1
10-89692978-C-G c.462C>G p.Phe154Leu Missense 5/9 - 5
10-89692978-C-A c.462C>A p.Phe154Leu Missense 5/9 - 5
10-89692976-T-C c.460T>C p.Phe154Leu Missense 5/9 - 5
10-89692977-T-G c.461T>G p.Phe154Cys Missense 5/9 - 1
10-89692977-T-C c.461T>C p.Phe154Ser Missense 5/9 - 1
10-89692979-T-C c.463T>C p.Tyr155His Missense 5/9 - 1
10-89692979-T-A c.463T>A p.Tyr155Asn Missense 5/9 - 3
10-89692980-A-G c.464A>G p.Tyr155Cys Missense 5/9 - 14
10-89692980-A-C c.464A>C p.Tyr155Ser Missense 5/9 - 2
10-89692980-A-T c.464A>T p.Tyr155Phe Missense 5/9 - 2
10-89692983-G-C c.467G>C p.Gly156Ala Missense 5/9 - 1
10-89692985-GAA-CAT c.469_471delinsCAT p.Glu157His Missense 5/9 - 1
10-89692985-G-T c.469G>T p.Glu157* Nonsense 5/9 - 1
10-89692986-A-G c.470A>G p.Glu157Gly Missense 5/9 - 3
10-89692988-GTA-TTT c.472_474delinsTTT p.Val158Phe Missense 5/9 - 4
10-89692988-G-T c.472G>T p.Val158Leu Missense 5/9 - 1
10-89692988-GTA-ATG c.472_474delinsATG p.Val158Met Missense 5/9 - 1
10-89692988-G-C c.472G>C p.Val158Leu Missense 5/9 - 1
10-89692991-A-G c.475A>G p.Arg159Gly Missense 5/9 - 1
10-89692991-AG-TA c.475_476delinsTA p.Arg159* Nonsense 5/9 - 1
10-89692992-G-A c.476G>A p.Arg159Lys Missense 5/9 - 2
10-89692992-G-C c.476G>C p.Arg159Thr Missense 5/9 - 2
10-89692993-G-T c.477G>T p.Arg159Ser Missense 5/9 - 7
10-89692997-AG-GC c.481_482delinsGC p.Arg161Ala Missense 5/9 - 4
10-89692997-AG-GA c.481_482delinsGA p.Arg161Glu Missense 5/9 - 1
10-89693000-G-T c.484G>T p.Asp162Tyr Missense 5/9 - 1
10-89693000-G-C c.484G>C p.Asp162His Missense 5/9 - 2
10-89693000-G-GG c.484dup p.Asp162Glyfs*18 Frameshift 5/9 - 1
10-89693002-C-G c.486C>G p.Asp162Glu Missense 5/9 - 1
10-89693002-C-CT c.486_487insT p.Lys163* Nonsense 5/9 - 1
10-89693002-AC-A c.486del p.Asp162Glufs*5 Frameshift 5/9 - 1
10-89693003-AA-GC c.487_488delinsGC p.Lys163Ala Missense 5/9 - 2
10-89693004-A-G c.488A>G p.Lys163Arg Missense 5/9 - 2
10-89693005-AAAAG-A c.489_492del p.Lys164Glufs*2 SpliceDonorDeletion 5/9 - 1
10-89693006-AA-GC c.490_491delinsGC p.Lys164Ala Missense 5/9 - 5
10-89693006-A-G c.490A>G p.Lys164Glu Missense 5/9 - 3
10-89693007-A-G c.491A>G p.Lys164Arg Missense 5/9 - 1
10-89693007-AA-A c.491del p.Lys164Argfs*3 Frameshift 5/9 - 5
10-89693008-G-C c.492G>C p.Lys164Asn Missense 5/9 - 2
10-89693008-G-T c.492G>T p.Lys164Asn Missense 5/9 - 2
10-89693009-G-T c.492+1G>T - IntronicSNV - 5/8 1
10-89697353-C-T c.492+4345C>T - IntronicSNV - 5/8 1
10-89698190-C-A c.492+5182C>A - IntronicSNV - 5/8 2
10-89700671-G-C c.492+7663G>C - IntronicSNV - 5/8 10
10-89700671-G-A c.492+7663G>A - IntronicSNV - 5/8 10
10-89704719-A-G c.493-7156A>G - IntronicSNV - 5/8 5
10-89705429-G-C c.493-6446G>C - IntronicSNV - 5/8 13
10-89707265-T-G c.493-4610T>G - IntronicSNV - 5/8 3
10-89707265-T-C c.493-4610T>C - IntronicSNV - 5/8 3
10-89709416-T-C c.493-2459T>C - IntronicSNV - 5/8 2
10-89711873-A-G c.493-2A>G - IntronicSNV - 5/8 1
10-89711875-G-A c.493G>A p.Gly165Arg Missense 6/9 - 9
10-89711875-G-T c.493G>T p.Gly165* Nonsense 6/9 - 5
10-89711875-GG-AT c.493_494delinsAT p.Gly165Ile Missense 6/9 - 1
10-89711876-G-A c.494G>A p.Gly165Glu Missense 6/9 - 7
10-89711876-G-T c.494G>T p.Gly165Val Missense 6/9 - 2
10-89711877-A-T c.495A>T p.Gly165Gly Synonymous 6/9 - 1
10-89711878-G-C c.496G>C p.Val166Leu Missense 6/9 - 1
10-89711878-G-T c.496G>T p.Val166Leu Missense 6/9 - 1
10-89711879-T-TT c.497dup p.Thr167Asnfs*13 Frameshift 6/9 - 1
10-89711881-AACTATTC-A c.499_505del p.Thr167Profs*14 Frameshift 6/9 - 2
10-89711881-A-G c.499A>G p.Thr167Ala Missense 6/9 - 8
10-89711882-C-A c.500C>A p.Thr167Asn Missense 6/9 - 4
10-89711882-C-G c.500C>G p.Thr167Ser Missense 6/9 - 1
10-89711881-A-T c.499A>T p.Thr167Ser Missense 6/9 - 1
10-89711884-A-C c.502A>C p.Ile168Leu Missense 6/9 - 1
10-89711887-CCC-TGG c.505_507delinsTGG p.Pro169Trp Missense 6/9 - 1
10-89711887-CC-GG c.505_506inv p.Pro169Gly Missense 6/9 - 1
10-89711889-CC-C c.507del p.Ser170Valfs*13 Frameshift 6/9 - 1
10-89711890-A-G c.508A>G p.Ser170Gly Missense 6/9 - 1
10-89711891-G-C c.509G>C p.Ser170Thr Missense 6/9 - 2
10-89711891-G-T c.509G>T p.Ser170Ile Missense 6/9 - 7
10-89711891-G-A c.509G>A p.Ser170Asn Missense 6/9 - 6
10-89711892-T-A c.510T>A p.Ser170Arg Missense 6/9 - 9
10-89711892-T-G c.510T>G p.Ser170Arg Missense 6/9 - 9
10-89711893-CA-GC c.511_512delinsGC p.Gln171Ala Missense 6/9 - 3
10-89711893-C-G c.511C>G p.Gln171Glu Missense 6/9 - 4
10-89711893-C-T c.511C>T p.Gln171* Nonsense 6/9 - 15
10-89711895-G-A c.513G>A p.Gln171Gln Synonymous 6/9 - 1
10-89711895-G-T c.513G>T p.Gln171His Missense 6/9 - 1
10-89711895-G-C c.513G>C p.Gln171His Missense 6/9 - 1
10-89711896-AG-CC c.514_515delinsCC p.Arg172Pro Missense 6/9 - 4
10-89711896-AGG-CAT c.514_516delinsCAT p.Arg172His Missense 6/9 - 56
10-89711897-G-A c.515G>A p.Arg172Lys Missense 6/9 - 1
10-89711898-G-C c.516G>C p.Arg172Ser Missense 6/9 - 1
10-89711898-G-T c.516G>T p.Arg172Ser Missense 6/9 - 1
10-89711899-C-T c.517C>T p.Arg173Cys Missense 6/9 - 41
10-89711899-CGC-TGA c.517_519delinsTGA p.Arg173* Nonsense 6/9 - 1
10-89711900-G-C c.518G>C p.Arg173Pro Missense 6/9 - 4
10-89711900-G-A c.518G>A p.Arg173His Missense 6/9 - 29
10-89711900-G-T c.518G>T p.Arg173Leu Missense 6/9 - 1
10-89711902-T-TT c.520dup p.Tyr174Leufs*6 Frameshift 6/9 - 1
10-89711902-T-G c.520T>G p.Tyr174Asp Missense 6/9 - 1
10-89711902-T-A c.520T>A p.Tyr174Asn Missense 6/9 - 2
10-89711903-A-T c.521A>T p.Tyr174Phe Missense 6/9 - 2
10-89711903-A-G c.521A>G p.Tyr174Cys Missense 6/9 - 2
10-89711905-G-A c.523G>A p.Val175Met Missense 6/9 - 1
10-89711906-T-C c.524T>C p.Val175Ala Missense 6/9 - 1
10-89711907-TGT-T c.525_526del p.Tyr176Leufs*3 Frameshift 6/9 - 1
10-89711909-A-G c.527A>G p.Tyr176Cys Missense 6/9 - 6
10-89711910-T-G c.528T>G p.Tyr176* Nonsense 6/9 - 1
10-89711910-T-A c.528T>A p.Tyr176* Nonsense 6/9 - 1
10-89711911-TA-AC c.529_530delinsAC p.Tyr177Thr Missense 6/9 - 1
10-89711911-T-C c.529T>C p.Tyr177His Missense 6/9 - 1
10-89711912-A-T c.530A>T p.Tyr177Phe Missense 6/9 - 1
10-89711913-T-G c.531T>G p.Tyr177* Nonsense 6/9 - 2
10-89711914-TTAT-T c.532_534del p.Tyr178del InFrameDeletion 6/9 - 1
10-89711916-T-A c.534T>A p.Tyr178* Nonsense 6/9 - 6
10-89711916-T-G c.534T>G p.Tyr178* Nonsense 6/9 - 6
10-89711917-AG-GC c.535_536delinsGC p.Ser179Ala Missense 6/9 - 1
10-89711917-A-T c.535A>T p.Ser179Cys Missense 6/9 - 1
10-89711920-TAC-GAG c.538_540delinsGAG p.Tyr180Glu Missense 6/9 - 1
10-89711920-T-C c.538T>C p.Tyr180His Missense 6/9 - 2
10-89711921-A-T c.539A>T p.Tyr180Phe Missense 6/9 - 2
10-89711922-C-A c.540C>A p.Tyr180* Nonsense 6/9 - 5
10-89711922-C-G c.540C>G p.Tyr180* Nonsense 6/9 - 3
10-89711923-C-A c.541C>A p.Leu181Met Missense 6/9 - 1
10-89711923-CC-C c.541del p.Leu181Cysfs*2 Frameshift 6/9 - 1
10-89711924-T-C c.542T>C p.Leu181Pro Missense 6/9 - 2
10-89711924-T-A c.542T>A p.Leu181Gln Missense 6/9 - 1
10-89711927-T-C c.545T>C p.Leu182Ser Missense 6/9 - 4
10-89711928-A-C c.546A>C p.Leu182Phe Missense 6/9 - 1
10-89711928-A-T c.546A>T p.Leu182Phe Missense 6/9 - 1
10-89711930-A-G c.548A>G p.Lys183Arg Missense 6/9 - 1
10-89711931-G-A c.549G>A p.Lys183Lys Synonymous 6/9 - 1
10-89711935-C-T c.553C>T p.His185Tyr Missense 6/9 - 1
10-89711940-G-A c.558G>A p.Leu186Leu Synonymous 6/9 - 1
10-89711944-T-C c.562T>C p.Tyr188His Missense 6/9 - 1
10-89711945-A-G c.563A>G p.Tyr188Cys Missense 6/9 - 1
10-89711945-A-T c.563A>T p.Tyr188Phe Missense 6/9 - 1
10-89711947-A-T c.565A>T p.Arg189* Nonsense 6/9 - 3
10-89711948-G-C c.566G>C p.Arg189Thr Missense 6/9 - 1
10-89711948-G-A c.566G>A p.Arg189Lys Missense 6/9 - 2
10-89711949-A-C c.567A>C p.Arg189Ser Missense 6/9 - 1
10-89711949-A-T c.567A>T p.Arg189Ser Missense 6/9 - 1
10-89711950-C-G c.568C>G p.Pro190Ala Missense 6/9 - 3
10-89711951-C-CC c.569dup p.Val191Serfs*11 Frameshift 6/9 - 1
10-89711951-C-T c.569C>T p.Pro190Leu Missense 6/9 - 1
10-89711951-CC-C c.569del p.Pro190Glnfs*9 Frameshift 6/9 - 1
10-89711953-GT-TC c.571_572delinsTC p.Val191Ser Missense 6/9 - 1
10-89711954-T-G c.572T>G p.Val191Gly Missense 6/9 - 1
10-89711954-T-C c.572T>C p.Val191Ala Missense 6/9 - 1
10-89711956-G-A c.574G>A p.Ala192Thr Missense 6/9 - 1
10-89711960-CT-C c.578del p.Leu193Argfs*6 Frameshift 6/9 - 1
10-89711961-G-A c.579G>A p.Leu193Leu Synonymous 6/9 - 1
10-89711961-G-C c.579G>C p.Leu193Leu Synonymous 6/9 - 1
10-89711961-G-T c.579G>T p.Leu193Leu Synonymous 6/9 - 1
10-89711959-C-T c.577C>T p.Leu193Leu Synonymous 6/9 - 1
10-89711964-G-C c.582G>C p.Leu194Phe Missense 6/9 - 1
10-89711964-G-T c.582G>T p.Leu194Phe Missense 6/9 - 1
10-89711965-T-C c.583T>C p.Phe195Leu Missense 6/9 - 1
10-89711967-T-A c.585T>A p.Phe195Leu Missense 6/9 - 1
10-89711967-T-G c.585T>G p.Phe195Leu Missense 6/9 - 1
10-89711971-A-T c.589A>T p.Lys197* Nonsense 6/9 - 1
10-89711972-A-T c.590A>T p.Lys197Met Missense 6/9 - 2
10-89711974-GA-G c.592del p.Met198* Frameshift 6/9 - 1
10-89711975-T-A c.593T>A p.Met198Lys Missense 6/9 - 2
10-89711975-T-G c.593T>G p.Met198Arg Missense 6/9 - 1
10-89711978-T-G c.596T>G p.Met199Arg Missense 6/9 - 4
10-89711980-TT-GC c.598_599delinsGC p.Phe200Ala Missense 6/9 - 1
10-89711983-G-T c.601G>T p.Glu201* Nonsense 6/9 - 2
10-89711983-G-A c.601G>A p.Glu201Lys Missense 6/9 - 1
10-89711985-A-C c.603A>C p.Glu201Asp Missense 6/9 - 1
10-89711985-A-T c.603A>T p.Glu201Asp Missense 6/9 - 1
10-89711986-AC-TG c.604_605delinsTG p.Thr202Cys Missense 6/9 - 1
10-89711986-ACT-TAA c.604_606delinsTAA p.Thr202* Nonsense 6/9 - 1
10-89711986-A-AA c.604dup p.Thr202Asnfs*41 Frameshift 6/9 - 1
10-89711986-AC-TA c.604_605delinsTA p.Thr202Tyr Missense 6/9 - 1
10-89711987-C-T c.605C>T p.Thr202Ile Missense 6/9 - 4
10-89711989-TAT-T c.607_608del p.Ile203Serfs*39 Frameshift 6/9 - 1
10-89711992-C-T c.610C>T p.Pro204Ser Missense 6/9 - 3
10-89711995-A-G c.613A>G p.Met205Val Missense 6/9 - 3
10-89711995-AT-GC c.613_614delinsGC p.Met205Ala Missense 6/9 - 2
10-89711997-G-C c.615G>C p.Met205Ile Missense 6/9 - 1
10-89711997-G-A c.615G>A p.Met205Ile Missense 6/9 - 1
10-89711997-G-T c.615G>T p.Met205Ile Missense 6/9 - 1
10-89712001-A-C c.619A>C p.Ser207Arg Missense 6/9 - 1
10-89712003-T-A c.621T>A p.Ser207Arg Missense 6/9 - 1
10-89712003-T-G c.621T>G p.Ser207Arg Missense 6/9 - 1
10-89712004-G-C c.622G>C p.Gly208Arg Missense 6/9 - 1
10-89712007-G-T c.625G>T p.Gly209* Nonsense 6/9 - 1
10-89712007-GGA-AGC c.625_627delinsAGC p.Gly209Ser Missense 6/9 - 1
10-89712010-AC-GA c.628_629delinsGA p.Thr210Asp Missense 6/9 - 3
10-89712013-TGC-CAA c.631_633delinsCAA p.Cys211Gln Missense 6/9 - 1
10-89712013-TG-GC c.631_632delinsGC p.Cys211Ala Missense 6/9 - 1
10-89712014-G-A c.632G>A p.Cys211Tyr Missense 6/9 - 2
10-89712014-G-GG c.632dup p.Cys211Trpfs*32 SpliceDonorInsertion 6/9 - 1
10-89712014-TGC-T c.632_633del p.Cys211* SpliceDonorDeletion 6/9 - 1
10-89712015-C-G c.633C>G p.Cys211Trp Missense 6/9 - 3
10-89712015-C-A c.633C>A p.Cys211* Nonsense 6/9 - 7
10-89712016-A-G c.634A>G p.Asn212Asp Missense 6/9 - 1
10-89712017-G-C c.634+1G>C - IntronicSNV - 6/8 1
10-89712018-T-C c.634+2T>C - IntronicSNV - 6/8 2
10-89712020-A-T c.634+4A>T - IntronicSNV - 6/8 1
10-89712021-G-C c.634+5G>C - IntronicSNV - 6/8 1
10-89712021-G-A c.634+5G>A - IntronicSNV - 6/8 1
10-89712473-G-A c.634+457G>A - IntronicSNV - 6/8 3
10-89716107-T-C c.635-1503T>C - IntronicSNV - 6/8 2
10-89717609-G-C c.635-1G>C - IntronicSNV - 6/8 1
10-89717610-GA-G c.635del p.Asn212Ilefs*9 Frameshift 7/9 - 1
10-89717610-GATCCTCAG-G c.635_642del p.Asn212Ilefs*28 SpliceAcceptorDeletion 7/9 - 1
10-89717612-C-T c.637C>T p.Pro213Ser Missense 7/9 - 1
10-89717615-C-T c.640C>T p.Gln214* Nonsense 7/9 - 11
10-89717616-A-T c.641A>T p.Gln214Leu Missense 7/9 - 1
10-89717616-CA-C c.641del p.Gln214Argfs*7 Frameshift 7/9 - 1
10-89717617-G-C c.642G>C p.Gln214His Missense 7/9 - 1
10-89717617-G-T c.642G>T p.Gln214His Missense 7/9 - 1
10-89717619-T-G c.644T>G p.Phe215Cys Missense 7/9 - 1
10-89717624-G-T c.649G>T p.Val217Phe Missense 7/9 - 1
10-89717625-T-A c.650T>A p.Val217Asp Missense 7/9 - 2
10-89717627-TG-GC c.652_653delinsGC p.Cys218Ala Missense 7/9 - 1
10-89717628-G-A c.653G>A p.Cys218Tyr Missense 7/9 - 1
10-89717629-C-A c.654C>A p.Cys218* Nonsense 7/9 - 2
10-89717629-C-T c.654C>T p.Cys218Cys Synonymous 7/9 - 2
10-89717630-C-T c.655C>T p.Gln219* Nonsense 7/9 - 5
10-89717632-G-GG c.657dup p.Leu220Alafs*23 Frameshift 7/9 - 1
10-89717633-C-G c.658C>G p.Leu220Val Missense 7/9 - 2
10-89717637-AA-A c.662del p.Lys221Argfs*2 Frameshift 7/9 - 1
10-89717637-A-G c.662A>G p.Lys221Arg Missense 7/9 - 1
10-89717638-G-C c.663G>C p.Lys221Asn Missense 7/9 - 1
10-89717638-G-T c.663G>T p.Lys221Asn Missense 7/9 - 1
10-89717641-G-GT c.666_667insT p.Lys223* Nonsense 7/9 - 1
10-89717642-A-T c.667A>T p.Lys223* Nonsense 7/9 - 1
10-89717647-A-AA c.672dup p.Tyr225Ilefs*18 Frameshift 7/9 - 2
10-89717649-A-G c.674A>G p.Tyr225Cys Missense 7/9 - 2
10-89717650-T-A c.675T>A p.Tyr225* Nonsense 7/9 - 2
10-89717650-T-G c.675T>G p.Tyr225* Nonsense 7/9 - 1
10-89717651-T-G c.676T>G p.Ser226Ala Missense 7/9 - 1
10-89717653-CC-C c.678del p.Ser227Profs*29 Frameshift 7/9 - 2
10-89717655-C-T c.680C>T p.Ser227Phe Missense 7/9 - 2
10-89717660-TCA-GAC c.685_687delinsGAC p.Ser229Asp Missense 7/9 - 1
10-89717660-T-G c.685T>G p.Ser229Ala Missense 7/9 - 2
10-89717661-C-T c.686C>T p.Ser229Leu Missense 7/9 - 1
10-89717661-C-A c.686C>A p.Ser229* Nonsense 7/9 - 4
10-89717663-G-T c.688G>T p.Gly230* Nonsense 7/9 - 2
10-89717666-CC-GA c.691_692delinsGA p.Pro231Asp Missense 7/9 - 1
10-89717669-A-G c.694A>G p.Thr232Ala Missense 7/9 - 1
10-89717671-A-AA c.696dup p.Arg233Thrfs*10 Frameshift 7/9 - 1
10-89717672-C-A c.697C>A p.Arg233Arg Synonymous 7/9 - 1
10-89717672-C-T c.697C>T p.Arg233* Nonsense 7/9 - 72
10-89717672-CG-GC c.697_698delinsGC p.Arg233Ala Missense 7/9 - 1
10-89717672-CG-AC c.697_698delinsAC p.Arg233Thr Missense 7/9 - 1
10-89717673-G-A c.698G>A p.Arg233Gln Missense 7/9 - 4
10-89717673-G-T c.698G>T p.Arg233Leu Missense 7/9 - 1
10-89717675-C-T c.700C>T p.Arg234Trp Missense 7/9 - 3
10-89717675-C-CCTGGAGCCGAC c.700_701insCTGGAGCCGAC p.Arg234Profs*26 Frameshift 7/9 - 1
10-89717676-G-A c.701G>A p.Arg234Gln Missense 7/9 - 11
10-89717676-G-T c.701G>T p.Arg234Leu Missense 7/9 - 1
10-89717678-GG-G c.703del p.Glu235Lysfs*21 Frameshift 7/9 - 1
10-89717681-G-GG c.706dup p.Asp236Glyfs*7 Frameshift 7/9 - 1
10-89717682-GACAAGTTCATGTAC-G c.707_720del p.Asp236Valfs*2 Frameshift 7/9 - 1
10-89717683-C-T c.708C>T p.Asp236Asp Synonymous 7/9 - 1
10-89717684-CAAGTTCA-C c.709_715del p.Lys237Cysfs*17 Frameshift 7/9 - 1
10-89717684-AA-GC c.709_710delinsGC p.Lys237Ala Missense 7/9 - 1
10-89717684-A-G c.709A>G p.Lys237Glu Missense 7/9 - 1
10-89717691-T-C c.716T>C p.Met239Thr Missense 7/9 - 1
10-89717693-TAC-GAG c.718_720delinsGAG p.Tyr240Glu Missense 7/9 - 1
10-89717694-A-T c.719A>T p.Tyr240Phe Missense 7/9 - 5
10-89717695-C-A c.720C>A p.Tyr240* Nonsense 7/9 - 2
10-89717696-T-C c.721T>C p.Phe241Leu Missense 7/9 - 1
10-89717698-T-A c.723T>A p.Phe241Leu Missense 7/9 - 1
10-89717698-T-G c.723T>G p.Phe241Leu Missense 7/9 - 1
10-89717697-T-C c.722T>C p.Phe241Ser Missense 7/9 - 12
10-89717698-T-TT c.723dup p.Glu242* Nonsense 7/9 - 3
10-89717699-TGAGTTCCCTCAGCCGTT-T c.724_740del p.Glu242Thrfs*5 Frameshift 7/9 - 1
10-89717699-G-T c.724G>T p.Glu242* Nonsense 7/9 - 1
10-89717705-C-T c.730C>T p.Pro244Ser Missense 7/9 - 1
10-89717706-CCTCAGCC-C c.731_737del p.Pro244Argfs*10 Frameshift 7/9 - 1
10-89717706-C-T c.731C>T p.Pro244Leu Missense 7/9 - 1
10-89717708-C-T c.733C>T p.Gln245* Nonsense 7/9 - 7
10-89717708-CA-AC c.733_734delinsAC p.Gln245Thr Missense 7/9 - 1
10-89717708-CAG-TAT c.733_735delinsTAT p.Gln245Tyr Missense 7/9 - 1
10-89717709-CA-C c.734del p.Gln245Argfs*11 Frameshift 7/9 - 1
10-89717709-CAGCC-C c.734_737del p.Gln245Argfs*10 Frameshift 7/9 - 1
10-89717711-C-T c.736C>T p.Pro246Ser Missense 7/9 - 1
10-89717711-C-CAG c.736_737insAG p.Pro246Glnfs*11 Frameshift 7/9 - 1
10-89717712-C-T c.737C>T p.Pro246Leu Missense 7/9 - 20
10-89717712-C-A c.737C>A p.Pro246Gln Missense 7/9 - 1
10-89717712-C-CAAG c.737_738insAAG p.Pro246_Leu247insArg InFrameInsertion 7/9 - 1
10-89717713-CG-C c.738del p.Leu247Tyrfs*9 Frameshift 7/9 - 1
10-89717714-TT-GA c.739_740delinsGA p.Leu247Glu Missense 7/9 - 1
10-89717715-T-C c.740T>C p.Leu247Ser Missense 7/9 - 1
10-89717716-A-AA c.741dup p.Pro248Thrfs*5 Frameshift 7/9 - 6
10-89717716-A-C c.741A>C p.Leu247Phe Missense 7/9 - 1
10-89717716-A-T c.741A>T p.Leu247Phe Missense 7/9 - 1
10-89717717-C-T c.742C>T p.Pro248Ser Missense 7/9 - 2
10-89717720-G-A c.745G>A p.Val249Met Missense 7/9 - 3
10-89717720-GT-TA c.745_746delinsTA p.Val249* Nonsense 7/9 - 2
10-89717721-T-C c.746T>C p.Val249Ala Missense 7/9 - 1
10-89717723-TG-GC c.748_749delinsGC p.Cys250Ala Missense 7/9 - 2
10-89717723-TG-AC c.748_749delinsAC p.Cys250Thr Missense 7/9 - 51
10-89717723-GTGT-G c.748_750del p.Cys250del InFrameDeletion 7/9 - 1
10-89717724-G-T c.749G>T p.Cys250Phe Missense 7/9 - 1
10-89717725-GTG-G c.750_751del p.Cys250Trpfs*2 Frameshift 7/9 - 1
10-89717725-T-G c.750T>G p.Cys250Trp Missense 7/9 - 1
10-89717726-G-T c.751G>T p.Gly251Cys Missense 7/9 - 5
10-89717726-GG-CT c.751_752delinsCT p.Gly251Leu Missense 7/9 - 1
10-89717727-G-T c.752G>T p.Gly251Val Missense 7/9 - 2
10-89717727-GT-AG c.752_753delinsAG p.Gly251Glu Missense 7/9 - 1
10-89717729-GAT-AAG c.754_756delinsAAG p.Asp252Lys Missense 7/9 - 1
10-89717729-G-A c.754G>A p.Asp252Asn Missense 7/9 - 3
10-89717729-G-T c.754G>T p.Asp252Tyr Missense 7/9 - 2
10-89717730-A-G c.755A>G p.Asp252Gly Missense 7/9 - 12
10-89717730-A-T c.755A>T p.Asp252Val Missense 7/9 - 2
10-89717732-A-T c.757A>T p.Ile253Phe Missense 7/9 - 1
10-89717732-A-AA c.757dup p.Ile253Asnfs*45 Frameshift 7/9 - 1
10-89717732-ATC-TGG c.757_759delinsTGG p.Ile253Trp Missense 7/9 - 1
10-89717733-T-G c.758T>G p.Ile253Ser Missense 7/9 - 1
10-89717733-T-A c.758T>A p.Ile253Asn Missense 7/9 - 3
10-89717735-A-T c.760A>T p.Lys254* Nonsense 7/9 - 1
10-89717736-A-C c.761A>C p.Lys254Thr Missense 7/9 - 1
10-89717736-A-G c.761A>G p.Lys254Arg Missense 7/9 - 6
10-89717737-A-AA c.762dup p.Val255Serfs*43 Frameshift 7/9 - 2
10-89717738-G-A c.763G>A p.Val255Ile Missense 7/9 - 1
10-89717738-GT-TA c.763_764delinsTA p.Val255* Nonsense 7/9 - 1
10-89717739-T-C c.764T>C p.Val255Ala Missense 7/9 - 3
10-89717740-A-AA c.765dup p.Glu256Argfs*42 Frameshift 7/9 - 1
10-89717741-G-A c.766G>A p.Glu256Lys Missense 7/9 - 3
10-89717741-G-T c.766G>T p.Glu256* Nonsense 7/9 - 1
10-89717742-A-G c.767A>G p.Glu256Gly Missense 7/9 - 1
10-89717746-C-G c.771C>G p.Phe257Leu Missense 7/9 - 1
10-89717744-T-C c.769T>C p.Phe257Leu Missense 7/9 - 1
10-89717746-C-A c.771C>A p.Phe257Leu Missense 7/9 - 1
10-89717745-T-C c.770T>C p.Phe257Ser Missense 7/9 - 1
10-89717749-C-A c.774C>A p.Phe258Leu Missense 7/9 - 1
10-89717749-C-G c.774C>G p.Phe258Leu Missense 7/9 - 1
10-89717747-T-C c.772T>C p.Phe258Leu Missense 7/9 - 1
10-89717748-TC-AA c.773_774delinsAA p.Phe258* Nonsense 7/9 - 1
10-89717753-A-T c.778A>T p.Lys260* Nonsense 7/9 - 1
10-89717753-AA-GC c.778_779delinsGC p.Lys260Ala Missense 7/9 - 2
10-89717753-A-AG c.778_779insG p.Lys260Argfs*38 Frameshift 7/9 - 1
10-89717753-AAA-GAC c.778_780delinsGAC p.Lys260Asp Missense 7/9 - 1
10-89717754-A-G c.779A>G p.Lys260Arg Missense 7/9 - 1
10-89717756-C-T c.781C>T p.Gln261* Nonsense 7/9 - 2
10-89717759-A-T c.784A>T p.Asn262Tyr Missense 7/9 - 5
10-89717762-AA-GC c.787_788delinsGC p.Lys263Ala Missense 7/9 - 3
10-89717763-A-G c.788A>G p.Lys263Arg Missense 7/9 - 2
10-89717765-AT-GC c.790_791delinsGC p.Met264Ala Missense 7/9 - 1
10-89717765-A-G c.790A>G p.Met264Val Missense 7/9 - 1
10-89717766-T-G c.791T>G p.Met264Arg Missense 7/9 - 1
10-89717767-G-A c.792G>A p.Met264Ile Missense 7/9 - 3
10-89717768-CT-GG c.793_794delinsGG p.Leu265Gly Missense 7/9 - 2
10-89717769-T-C c.794T>C p.Leu265Pro Missense 7/9 - 1
10-89717771-AA-GC c.796_797delinsGC p.Lys266Ala Missense 7/9 - 4
10-89717771-AAA-GAC c.796_798delinsGAC p.Lys266Asp Missense 7/9 - 1
10-89717771-A-T c.796A>T p.Lys266* Nonsense 7/9 - 1
10-89717772-A-G c.797A>G p.Lys266Arg Missense 7/9 - 4
10-89717773-A-C c.798A>C p.Lys266Asn Missense 7/9 - 2
10-89717773-A-T c.798A>T p.Lys266Asn Missense 7/9 - 2
10-89717773-A-AT c.798_799insT p.Lys267* Nonsense 7/9 - 2
10-89717774-A-C c.799A>C p.Lys267Gln Missense 7/9 - 1
10-89717774-A-AC c.799_800insC p.Lys267Thrfs*31 SpliceDonorInsertion 7/9 - 2
10-89717774-AA-GC c.799_800delinsGC p.Lys267Ala Missense 7/9 - 3
10-89717775-AA-A c.800del p.Lys267Argfs*9 Frameshift 7/9 - 19
10-89717775-AAG-A c.800_801del p.Lys267Argfs*30 SpliceDonorDeletion 7/9 - 2
10-89717775-A-G c.800A>G p.Lys267Arg Missense 7/9 - 2
10-89717776-G-C c.801G>C p.Lys267Asn Missense 7/9 - 1
10-89717776-G-T c.801G>T p.Lys267Asn Missense 7/9 - 1
10-89717777-GG-G c.801+1del - IntronicDeletion - 7/8 2
10-89717799-G-A c.801+23G>A - IntronicSNV - 7/8 1
10-89720251-T-C c.802-400T>C - IntronicSNV - 7/8 3
10-89720649-A-G c.802-2A>G - IntronicSNV - 7/8 1
10-89720649-A-T c.802-2A>T - IntronicSNV - 7/8 3
10-89720650-G-C c.802-1G>C - IntronicSNV - 7/8 1
10-89720651-GG-G c.802del p.Asp268Thrfs*8 Frameshift 8/9 - 2
10-89720653-C-A c.804C>A p.Asp268Glu Missense 8/9 - 3
10-89720654-AA-GC c.805_806delinsGC p.Lys269Ala Missense 8/9 - 3
10-89720654-A-G c.805A>G p.Lys269Glu Missense 8/9 - 2
10-89720654-A-C c.805A>C p.Lys269Gln Missense 8/9 - 1
10-89720654-A-T c.805A>T p.Lys269* Nonsense 8/9 - 1
10-89720654-AAA-GAC c.805_807delinsGAC p.Lys269Asp Missense 8/9 - 1
10-89720659-G-T c.810G>T p.Met270Ile Missense 8/9 - 3
10-89720662-T-G c.813T>G p.Phe271Leu Missense 8/9 - 1
10-89720662-T-A c.813T>A p.Phe271Leu Missense 8/9 - 1
10-89720660-TT-GA c.811_812delinsGA p.Phe271Asp Missense 8/9 - 1
10-89720660-T-G c.811T>G p.Phe271Val Missense 8/9 - 1
10-89720660-T-C c.811T>C p.Phe271Leu Missense 8/9 - 1
10-89720661-T-C c.812T>C p.Phe271Ser Missense 8/9 - 1
10-89720663-C-T c.814C>T p.His272Tyr Missense 8/9 - 2
10-89720668-T-A c.819T>A p.Phe273Leu Missense 8/9 - 1
10-89720668-T-G c.819T>G p.Phe273Leu Missense 8/9 - 1
10-89720666-T-C c.817T>C p.Phe273Leu Missense 8/9 - 1
10-89720666-TT-GC c.817_818delinsGC p.Phe273Ala Missense 8/9 - 1
10-89720671-G-A c.822G>A p.Trp274* Nonsense 8/9 - 5
10-89720670-G-T c.821G>T p.Trp274Leu Missense 8/9 - 3
10-89720671-G-GTA c.822_823insTA p.Val275* Nonsense 8/9 - 2
10-89720672-GG-G c.823del p.Val275* Frameshift 8/9 - 3
10-89720676-A-G c.827A>G p.Asn276Ser Missense 8/9 - 4
10-89720677-T-G c.828T>G p.Asn276Lys Missense 8/9 - 1
10-89720677-T-A c.828T>A p.Asn276Lys Missense 8/9 - 1
10-89720678-A-G c.829A>G p.Thr277Ala Missense 8/9 - 3
10-89720679-C-T c.830C>T p.Thr277Ile Missense 8/9 - 2
10-89720679-C-G c.830C>G p.Thr277Arg Missense 8/9 - 1
10-89720681-T-C c.832T>C p.Phe278Leu Missense 8/9 - 1
10-89720683-C-A c.834C>A p.Phe278Leu Missense 8/9 - 1
10-89720683-C-G c.834C>G p.Phe278Leu Missense 8/9 - 1
10-89720682-T-C c.833T>C p.Phe278Ser Missense 8/9 - 1
10-89720687-A-G c.838A>G p.Ile280Val Missense 8/9 - 1
10-89720691-C-T c.842C>T p.Pro281Leu Missense 8/9 - 1
10-89720692-CAGGACCAGAGGAAACC-C c.843_858del p.Gly282Glnfs*4 Frameshift 8/9 - 1
10-89720698-CA-C c.849del p.Glu284Argfs*7 Frameshift 8/9 - 1
10-89720699-G-T c.850G>T p.Glu284* Nonsense 8/9 - 1
10-89720700-GAG-G c.851_852del p.Glu284Glyfs*13 Frameshift 8/9 - 1
10-89720702-G-A c.853G>A p.Glu285Lys Missense 8/9 - 1
10-89720702-G-T c.853G>T p.Glu285* Nonsense 8/9 - 1
10-89720705-A-G c.856A>G p.Thr286Ala Missense 8/9 - 14
10-89720711-AG-A c.862del p.Glu288Lysfs*3 Frameshift 8/9 - 1
10-89720711-G-T c.862G>T p.Glu288* Nonsense 8/9 - 2
10-89720712-A-T c.863A>T p.Glu288Val Missense 8/9 - 1
10-89720714-A-G c.865A>G p.Lys289Glu Missense 8/9 - 31
10-89720715-A-G c.866A>G p.Lys289Arg Missense 8/9 - 6
10-89720716-A-ATA c.867_868insTA p.Val290* Nonsense 8/9 - 1
10-89720716-AAG-A c.867_868del p.Lys289Asnfs*8 Frameshift 8/9 - 1
10-89720716-A-G c.867A>G p.Lys289Lys Synonymous 8/9 - 1
10-89720716-AA-A c.867del p.Val290* Frameshift 8/9 - 2
10-89720717-GTA-ATG c.868_870delinsATG p.Val290Met Missense 8/9 - 1
10-89720717-GT-TA c.868_869delinsTA p.Val290* Nonsense 8/9 - 1
10-89720729-AA-A c.880del p.Ser294Valfs*13 Frameshift 8/9 - 1
10-89720731-T-G c.882T>G p.Ser294Arg Missense 8/9 - 2
10-89720731-T-C c.882T>C p.Ser294Ser Synonymous 8/9 - 1
10-89720732-C-CC c.883dup p.Leu295Profs*3 Frameshift 8/9 - 1
10-89720732-CT-TA c.883_884delinsTA p.Leu295* Nonsense 8/9 - 1
10-89720733-T-TT c.884dup p.Cys296Metfs*2 Frameshift 8/9 - 1
10-89720735-TG-GC c.886_887delinsGC p.Cys296Ala Missense 8/9 - 1
10-89720737-T-A c.888T>A p.Cys296* Nonsense 8/9 - 1
10-89720741-C-T c.892C>T p.Gln298* Nonsense 8/9 - 6
10-89720741-C-G c.892C>G p.Gln298Glu Missense 8/9 - 2
10-89720744-G-T c.895G>T p.Glu299* Nonsense 8/9 - 2
10-89720748-ATC-A c.899_900del p.Ile300Argfs*2 Frameshift 8/9 - 1
10-89720750-G-A c.901G>A p.Asp301Asn Missense 8/9 - 2
10-89720752-T-C c.903T>C p.Asp301Asp Synonymous 8/9 - 1
10-89720753-A-G c.904A>G p.Ser302Gly Missense 8/9 - 1
10-89720753-AG-GC c.904_905delinsGC p.Ser302Ala Missense 8/9 - 2
10-89720753-AGC-GAG c.904_906delinsGAG p.Ser302Glu Missense 8/9 - 1
10-89720756-ATT-GAG c.907_909delinsGAG p.Ile303Glu Missense 8/9 - 1
10-89720759-TG-GC c.910_911delinsGC p.Cys304Ala Missense 8/9 - 1
10-89720762-A-AT c.913_914insT p.Ser305Metfs*7 Frameshift 8/9 - 1
10-89720766-ATA-A c.917_918del p.Ile306Argfs*5 Frameshift 8/9 - 1
10-89720768-G-A c.919G>A p.Glu307Lys Missense 8/9 - 7
10-89720771-CGT-TGA c.922_924delinsTGA p.Arg308* Nonsense 8/9 - 1
10-89720771-CGT-GAG c.922_924delinsGAG p.Arg308Glu Missense 8/9 - 1
10-89720772-G-A c.923G>A p.Arg308His Missense 8/9 - 1
10-89720774-GC-TA c.925_926delinsTA p.Ala309* Nonsense 8/9 - 1
10-89720775-C-CCC c.926_927insCC p.Asp310Glnfs*8 Frameshift 8/9 - 1
10-89720777-G-C c.928G>C p.Asp310His Missense 8/9 - 1
10-89720778-A-G c.929A>G p.Asp310Gly Missense 8/9 - 2
10-89720779-ATA-A c.930_931del p.Asp310Glufs*2 Frameshift 8/9 - 1
10-89720780-A-C c.931A>C p.Asn311His Missense 8/9 - 1
10-89720780-AA-GC c.931_932delinsGC p.Asn311Ala Missense 8/9 - 1
10-89720783-G-A c.934G>A p.Asp312Asn Missense 8/9 - 1
10-89720786-AA-GC c.937_938delinsGC p.Lys313Ala Missense 8/9 - 1
10-89720787-A-G c.938A>G p.Lys313Arg Missense 8/9 - 2
10-89720788-AGGAA-A c.939_942del p.Lys313Asnfs*3 Frameshift 8/9 - 1
10-89720789-G-GG c.940dup p.Glu314Glyfs*11 Frameshift 8/9 - 1
10-89720789-G-T c.940G>T p.Glu314* Nonsense 8/9 - 3
10-89720793-A-T c.944A>T p.Tyr315Phe Missense 8/9 - 5
10-89720794-T-A c.945T>A p.Tyr315* Nonsense 8/9 - 1
10-89720798-GT-TA c.949_950delinsTA p.Val317* Nonsense 8/9 - 1
10-89720803-T-TTA c.954_955insTA p.Thr319* Nonsense 8/9 - 2
10-89720804-ACT-TAA c.955_957delinsTAA p.Thr319* Nonsense 8/9 - 4
10-89720804-A-AA c.955dup p.Thr319Asnfs*6 Frameshift 8/9 - 5
10-89720804-A-G c.955A>G p.Thr319Ala Missense 8/9 - 2
10-89720804-ACT-GAG c.955_957delinsGAG p.Thr319Glu Missense 8/9 - 1
10-89720804-AC-TA c.955_956delinsTA p.Thr319Tyr Missense 8/9 - 1
10-89720804-TACTT-T c.955_958del p.Thr319* Frameshift 8/9 - 11
10-89720805-ACTTT-A c.956_959del p.Thr319Lysfs*24 Frameshift 8/9 - 1
10-89720806-T-G c.957T>G p.Thr319Thr Synonymous 8/9 - 2
10-89720806-T-C c.957T>C p.Thr319Thr Synonymous 8/9 - 2
10-89720806-T-A c.957T>A p.Thr319Thr Synonymous 8/9 - 2
10-89720807-TTA-GAC c.958_960delinsGAC p.Leu320Asp Missense 8/9 - 1
10-89720807-TT-GC c.958_959delinsGC p.Leu320Ala Missense 8/9 - 1
10-89720807-TT-GA c.958_959delinsGA p.Leu320Glu Missense 8/9 - 1
10-89720808-T-A c.959T>A p.Leu320* Nonsense 8/9 - 5
10-89720808-T-G c.959T>G p.Leu320* Nonsense 8/9 - 7
10-89720808-T-C c.959T>C p.Leu320Ser Missense 8/9 - 5
10-89720810-A-G c.961A>G p.Thr321Ala Missense 8/9 - 3
10-89720810-AC-GA c.961_962delinsGA p.Thr321Glu Missense 8/9 - 1
10-89720811-C-CTGACAAGGAATATCTAGTACTT c.962_963insTGACAAGGAATATCTAGTACTT p.Lys322Aspfs*10 Frameshift 8/9 - 1
10-89720813-A-T c.964A>T p.Lys322* Nonsense 8/9 - 1
10-89720814-A-G c.965A>G p.Lys322Arg Missense 8/9 - 2
10-89720815-A-AT c.966_967insT p.Asn323* Nonsense 8/9 - 1
10-89720817-AA-A c.968del p.Asn323Metfs*21 Frameshift 8/9 - 4
10-89720817-A-AA c.968dup p.Asn323Lysfs*2 Frameshift 8/9 - 8
10-89720819-G-GG c.970dup p.Asp324Glyfs*3 Frameshift 8/9 - 1
10-89720822-C-T c.973C>T p.Leu325Phe Missense 8/9 - 4
10-89720823-T-G c.974T>G p.Leu325Arg Missense 8/9 - 2
10-89720825-G-A c.976G>A p.Asp326Asn Missense 8/9 - 10
10-89720826-A-G c.977A>G p.Asp326Gly Missense 8/9 - 1
10-89720828-AA-GC c.979_980delinsGC p.Lys327Ala Missense 8/9 - 2
10-89720828-AAA-GAC c.979_981delinsGAC p.Lys327Asp Missense 8/9 - 1
10-89720828-A-G c.979A>G p.Lys327Glu Missense 8/9 - 1
10-89720832-C-A c.983C>A p.Ala328Glu Missense 8/9 - 1
10-89720832-C-T c.983C>T p.Ala328Val Missense 8/9 - 1
10-89720834-A-C c.985A>C p.Asn329His Missense 8/9 - 5
10-89720835-A-T c.986A>T p.Asn329Ile Missense 8/9 - 1
10-89720836-ATAAA-A c.987_990del p.Asn329Lysfs*14 Frameshift 8/9 - 2
10-89720836-T-TT c.987dup p.Lys330* Nonsense 8/9 - 2
10-89720837-AA-GC c.988_989delinsGC p.Lys330Ala Missense 8/9 - 2
10-89720837-AAA-GAC c.988_990delinsGAC p.Lys330Asp Missense 8/9 - 1
10-89720837-A-G c.988A>G p.Lys330Glu Missense 8/9 - 1
10-89720840-G-A c.991G>A p.Asp331Asn Missense 8/9 - 1
10-89720841-A-G c.992A>G p.Asp331Gly Missense 8/9 - 3
10-89720841-A-C c.992A>C p.Asp331Ala Missense 8/9 - 5
10-89720842-ACAAAGCCAACCGATACTTTTCTCCAAATTTTAAGGTCAGTTAAATTAAACATTTTGTGG-A c.993_1026+25del - Multi:SpliceDonorDeletion,SpliceAcceptorDeletion 8/9 8/8 1
10-89720843-AAA-GAC c.994_996delinsGAC p.Lys332Asp Missense 8/9 - 1
10-89720843-AA-GC c.994_995delinsGC p.Lys332Ala Missense 8/9 - 1
10-89720844-A-G c.995A>G p.Lys332Arg Missense 8/9 - 1
10-89720850-A-G c.1001A>G p.Asn334Ser Missense 8/9 - 1
10-89720851-C-G c.1002C>G p.Asn334Lys Missense 8/9 - 1
10-89720851-C-A c.1002C>A p.Asn334Lys Missense 8/9 - 1
10-89720852-C-T c.1003C>T p.Arg335* Nonsense 8/9 - 46
10-89720852-CG-GT c.1003_1004delinsGT p.Arg335Val Missense 8/9 - 1
10-89720852-CG-GC c.1003_1004delinsGC p.Arg335Ala Missense 8/9 - 2
10-89720852-CGA-GAC c.1003_1005delinsGAC p.Arg335Asp Missense 8/9 - 1
10-89720853-G-A c.1004G>A p.Arg335Gln Missense 8/9 - 3
10-89720853-G-T c.1004G>T p.Arg335Leu Missense 8/9 - 5
10-89720856-A-AA c.1007dup p.Tyr336* Nonsense 8/9 - 1
10-89720856-A-T c.1007A>T p.Tyr336Phe Missense 8/9 - 1
10-89720857-C-G c.1008C>G p.Tyr336* Nonsense 8/9 - 8
10-89720857-AC-A c.1008del p.Ser338Leufs*6 Frameshift 8/9 - 1
10-89720859-T-C c.1010T>C p.Phe337Ser Missense 8/9 - 2
10-89720861-TT-T c.1012del p.Ser338Leufs*6 Frameshift 8/9 - 1
10-89720864-C-T c.1015C>T p.Pro339Ser Missense 8/9 - 2
10-89720865-C-A c.1016C>A p.Pro339Gln Missense 8/9 - 1
10-89720865-C-T c.1016C>T p.Pro339Leu Missense 8/9 - 2
10-89720872-T-G c.1023T>G p.Phe341Leu Missense 8/9 - 2
10-89720870-T-G c.1021T>G p.Phe341Val Missense 8/9 - 5
10-89720871-T-A c.1022T>A p.Phe341Tyr Missense 8/9 - 1
10-89720873-A-G c.1024A>G p.Lys342Glu Missense 8/9 - 2
10-89720874-A-G c.1025A>G p.Lys342Arg Missense 8/9 - 1
10-89720874-A-C c.1025A>C p.Lys342Thr Missense 8/9 - 1
10-89720875-G-C c.1026G>C p.Lys342Asn Missense 8/9 - 5
10-89720875-G-T c.1026G>T p.Lys342Asn Missense 8/9 - 5
10-89720876-G-C c.1026+1G>C - IntronicSNV - 8/8 1
10-89720876-G-A c.1026+1G>A - IntronicSNV - 8/8 4
10-89720907-T-G c.1026+32T>G - IntronicSNV - 8/8 9
10-89721094-C-T c.1026+219C>T - IntronicSNV - 8/8 3
10-89721412-C-T c.1026+537C>T - IntronicSNV - 8/8 5
10-89723342-C-T c.1027-1702C>T - IntronicSNV - 8/8 8
10-89725042-A-G c.1027-2A>G - IntronicSNV - 8/8 1
10-89725042-A-C c.1027-2A>C - IntronicSNV - 8/8 2
10-89725043-G-A c.1027-1G>A - IntronicSNV - 8/8 1
10-89725044-G-GG c.1027dup p.Val343Glyfs*18 SpliceAcceptorInsertion 9/9 - 1
10-89725045-T-A c.1028T>A p.Val343Glu Missense 9/9 - 6
10-89725045-T-G c.1028T>G p.Val343Gly Missense 9/9 - 1
10-89725047-A-G c.1030A>G p.Lys344Glu Missense 9/9 - 1
10-89725048-A-G c.1031A>G p.Lys344Arg Missense 9/9 - 4
10-89725050-CTG-TTT c.1033_1035delinsTTT p.Leu345Phe Missense 9/9 - 1
10-89725050-C-G c.1033C>G p.Leu345Val Missense 9/9 - 7
10-89725051-T-A c.1034T>A p.Leu345Gln Missense 9/9 - 3
10-89725051-T-C c.1034T>C p.Leu345Pro Missense 9/9 - 1
10-89725054-A-G c.1037A>G p.Tyr346Cys Missense 9/9 - 1
10-89725056-T-C c.1039T>C p.Phe347Leu Missense 9/9 - 4
10-89725059-ACA-GAC c.1042_1044delinsGAC p.Thr348Asp Missense 9/9 - 1
10-89725059-A-G c.1042A>G p.Thr348Ala Missense 9/9 - 1
10-89725060-C-T c.1043C>T p.Thr348Ile Missense 9/9 - 3
10-89725063-A-G c.1046A>G p.Lys349Arg Missense 9/9 - 2
10-89725069-GTAG-G c.1052_1054del p.Val351del InFrameDeletion 9/9 - 1
10-89725077-CC-TG c.1060_1061delinsTG p.Pro354Trp Missense 9/9 - 1
10-89725078-C-A c.1061C>A p.Pro354Gln Missense 9/9 - 4
10-89725078-C-T c.1061C>T p.Pro354Leu Missense 9/9 - 1
10-89725083-A-G c.1066A>G p.Asn356Asp Missense 9/9 - 3
10-89725099-G-A c.1082G>A p.Ser361Asn Missense 9/9 - 2
10-89725101-T-G c.1084T>G p.Ser362Ala Missense 9/9 - 1
10-89725102-C-T c.1085C>T p.Ser362Leu Missense 9/9 - 1
10-89725105-C-A c.1088C>A p.Thr363Asn Missense 9/9 - 1
10-89725107-T-G c.1090T>G p.Ser364Ala Missense 9/9 - 1
10-89725109-T-C c.1092T>C p.Ser364Ser Synonymous 9/9 - 1
10-89725109-T-A c.1092T>A p.Ser364Ser Synonymous 9/9 - 1
10-89725109-T-G c.1092T>G p.Ser364Ser Synonymous 9/9 - 1
10-89725113-A-T c.1096A>T p.Thr366Ser Missense 9/9 - 1
10-89725113-A-G c.1096A>G p.Thr366Ala Missense 9/9 - 12
10-89725113-AA-A c.1096del p.Thr366Hisfs*50 Frameshift 9/9 - 1
10-89725113-ACA-GAC c.1096_1098delinsGAC p.Thr366Asp Missense 9/9 - 1
10-89725113-ACA-TGG c.1096_1098delinsTGG p.Thr366Trp Missense 9/9 - 1
10-89725121-T-C c.1104T>C p.Asp368Asp Synonymous 9/9 - 1
10-89725125-AG-GA c.1108_1109delinsGA p.Ser370Asp Missense 9/9 - 2
10-89725125-AG-GC c.1108_1109delinsGC p.Ser370Ala Missense 9/9 - 15
10-89725128-G-A c.1111G>A p.Asp371Asn Missense 9/9 - 1
10-89725137-C-A c.1120C>A p.Pro374Thr Missense 9/9 - 1
10-89725143-CA-GC c.1126_1127delinsGC p.His376Ala Missense 9/9 - 1
10-89725149-AG-GC c.1132_1133delinsGC p.Arg378Ala Missense 9/9 - 1
10-89725150-G-T c.1133G>T p.Arg378Ile Missense 9/9 - 1
10-89725150-AGATA-A c.1133_1136del p.Arg378Ilefs*37 Frameshift 9/9 - 2
10-89725152-T-A c.1135T>A p.Tyr379Asn Missense 9/9 - 1
10-89725152-T-G c.1135T>G p.Tyr379Asp Missense 9/9 - 1
10-89725153-A-G c.1136A>G p.Tyr379Cys Missense 9/9 - 5
10-89725155-TCT-GAG c.1138_1140delinsGAG p.Ser380Glu Missense 9/9 - 6
10-89725155-T-C c.1138T>C p.Ser380Pro Missense 9/9 - 1
10-89725155-T-G c.1138T>G p.Ser380Ala Missense 9/9 - 36
10-89725155-TC-GA c.1138_1139inv p.Ser380Asp Missense 9/9 - 3
10-89725156-C-T c.1139C>T p.Ser380Phe Missense 9/9 - 1
10-89725159-A-T c.1142A>T p.Asp381Val Missense 9/9 - 2
10-89725160-C-T c.1143C>T p.Asp381Asp Synonymous 9/9 - 1
10-89725161-AC-GA c.1144_1145delinsGA p.Thr382Asp Missense 9/9 - 1
10-89725161-A-G c.1144A>G p.Thr382Ala Missense 9/9 - 28
10-89725161-ACC-GAG c.1144_1146delinsGAG p.Thr382Glu Missense 9/9 - 4
10-89725162-C-G c.1145C>G p.Thr382Ser Missense 9/9 - 1
10-89725162-C-T c.1145C>T p.Thr382Ile Missense 9/9 - 1
10-89725161-A-T c.1144A>T p.Thr382Ser Missense 9/9 - 1
10-89725164-ACT-GAG c.1147_1149delinsGAG p.Thr383Glu Missense 9/9 - 6
10-89725164-A-G c.1147A>G p.Thr383Ala Missense 9/9 - 35
10-89725164-A-C c.1147A>C p.Thr383Pro Missense 9/9 - 1
10-89725164-AC-GA c.1147_1148delinsGA p.Thr383Asp Missense 9/9 - 2
10-89725165-C-T c.1148C>T p.Thr383Ile Missense 9/9 - 1
10-89725167-G-A c.1150G>A p.Asp384Asn Missense 9/9 - 1
10-89725168-A-T c.1151A>T p.Asp384Val Missense 9/9 - 1
10-89725170-TCT-GAG c.1153_1155delinsGAG p.Ser385Glu Missense 9/9 - 3
10-89725170-TC-GA c.1153_1154inv p.Ser385Asp Missense 9/9 - 1
10-89725170-T-G c.1153T>G p.Ser385Ala Missense 9/9 - 20
10-89725177-C-T c.1160C>T p.Pro387Leu Missense 9/9 - 1
10-89725184-T-G c.1167T>G p.Asn389Lys Missense 9/9 - 1
10-89725188-C-T c.1171C>T p.Pro391Ser Missense 9/9 - 1
10-89725195-A-C c.1178A>C p.Asp393Ala Missense 9/9 - 2
10-89725206-C-T c.1189C>T p.His397Tyr Missense 9/9 - 1
10-89725207-A-G c.1190A>G p.His397Arg Missense 9/9 - 1
10-89725209-AC-GA c.1192_1193delinsGA p.Thr398Glu Missense 9/9 - 1
10-89725209-A-T c.1192A>T p.Thr398Ser Missense 9/9 - 1
10-89725209-ACA-GAC c.1192_1194delinsGAC p.Thr398Asp Missense 9/9 - 1
10-89725209-A-G c.1192A>G p.Thr398Ala Missense 9/9 - 5
10-89725209-AC-CA c.1192_1193delinsCA p.Thr398Gln Missense 9/9 - 1
10-89725210-CA-AC c.1193_1194delinsAC p.Thr398Asn Missense 9/9 - 1
10-89725212-C-T c.1195C>T p.Gln399* Nonsense 9/9 - 2
10-89725219-C-T c.1202C>T p.Thr401Ile Missense 9/9 - 1
10-89725221-A-C c.1204A>C p.Lys402Gln Missense 9/9 - 1
10-89725222-A-G c.1205A>G p.Lys402Arg Missense 9/9 - 1
10-89725227-T-G c.1210T>G p.*404Glyext*8 Missense 9/9 - 1
10-89725228-G-C c.1211G>C p.*404Serext*8 Missense 9/9 - 1
10-89725294-T-C c.*65T>C - 3-UTRSNV 9/9 - 1
10-89725304-T-A c.*75T>A - 3-UTRSNV 9/9 - 1
10-89725454-T-G c.*225T>G - 3-UTRSNV 9/9 - 1
10-89726624-C-A c.*1395C>A - 3-UTRSNV 9/9 - 1
10-89726728-C-T c.*1499C>T - 3-UTRSNV 9/9 - 1
10-89726745-T-C c.*1516T>C - 3-UTRSNV 9/9 - 21
10-89727414-C-T c.*2185C>T - 3-UTRSNV 9/9 - 8