Publications:

---

Network expansion of genetic associations defines a pleiotropy map of human cell biology.

Nature Genetics

Barrio-Hernandez, Inigo I; Schwartzentruber, Jeremy J; Shrivastava, Anjali A; Del-Toro, Noemi N; Gonzalez, Asier A; Zhang, Qian Q; Mountjoy, Edward E; Suveges, Daniel D; Ochoa, David D; Ghoussaini, Maya M; Bradley, Glyn G; Hermjakob, Henning H; Orchard, Sandra S; Dunham, Ian I; Anderson, Carl A CA; Porras, Pablo P; Beltrao, Pedro P

Publication Date: 2023-02-23

Variant appearance in text: ARID1A: 31_56del; Ser11fs

PubMed Link: 36823319

Variant Present in the following documents:

• 41588_2023_1327_MOESM4_ESM.xlsx, sheet 6

View BVdb publication page

---

Genomic complexity predicts resistance to endocrine therapy and CDK4/6 inhibition in hormone receptor-positive (HR+)/HER2-negative metastatic breast cancer.

Clinical Cancer Research : An Official Journal Of The American Association For Cancer Research

Davis, Andrew A AA; Luo, Jingqin J; Zheng, Tiantian T; Dai, Chao C; Dong, Xiaoxi X; Tan, Lu L; Suresh, Rama R; Ademuyiwa, Foluso O FO; Rigden, Caron C; Rearden, Timothy P TP; Clifton, Katherine K; Weilbaecher, Katherine K; Frith, Ashley A; Tandra, Pavankumar K PK; Summa, Tracy T; Haas, Brittney B; Thomas, Shana S; Hernandez-Aya, Leonel F LF; Peterson, Lindsay L LL; Wang, Xiaohong X; Luo, Shujun J SJ; Zhou, Kemin K; Du, Pan P; Jia, Shidong S; King, Bonnie L BL; Krishnamurthy, Jairam J; Ma, Cynthia X CX

Publication Date: 2023-01-24

Variant appearance in text: ARID1A: 31_56del

PubMed Link: 36693175

Variant Present in the following documents:

• ccr-22-2177_supplementary_data_s1_suppds1.xlsx, sheet 3

View BVdb publication page

---

A transcriptional network of cell cycle dysregulation in noninvasive papillary urothelial carcinoma.

Scientific Reports

Warrick, Joshua I JI; Knowles, Margaret A MA; Hurst, Carolyn D CD; Shuman, Lauren L; Raman, Jay D JD; Walter, Vonn V; Putt, Jeffrey J; Dyrskjøt, Lars L; Groeneveld, Clarice C; Castro, Mauro A A MAA; Robertson, A Gordon AG; DeGraff, David J DJ

Publication Date: 2022-10-03

Variant appearance in text: ARID1A: 31_56del; S11Afs*91

PubMed Link: 36192513

Variant Present in the following documents:

• 41598_2022_20927_MOESM14_ESM.xlsx, sheet 1

View BVdb publication page

---

Clinical relevance of molecular characteristics in Burkitt lymphoma differs according to age.

Nature Communications

Burkhardt, Birgit B; Michgehl, Ulf U; Rohde, Jonas J; Erdmann, Tabea T; Berning, Philipp P; Reutter, Katrin K; Rohde, Marius M; Borkhardt, Arndt A; Burmeister, Thomas T; Dave, Sandeep S; Tzankov, Alexandar A; Dugas, Martin M; Sandmann, Sarah S; Fend, Falko F; Finger, Jasmin J; Mueller, Stephanie S; Gökbuget, Nicola N; Haferlach, Torsten T; Kern, Wolfgang W; Hartmann, Wolfgang W; Klapper, Wolfram W; Oschlies, Ilske I; Richter, Julia J; Kontny, Udo U; Lutz, Mathias M; Maecker-Kolhoff, Britta B; Ott, German G; Rosenwald, Andreas A; Siebert, Reiner R; von Stackelberg, Arend A; Strahm, Brigitte B; Woessmann, Wilhelm W; Zimmermann, Martin M; Zapukhlyak, Myroslav M; Grau, Michael M; Lenz, Georg G

Publication Date: 2022-07-06

Variant appearance in text: ARID1A: 31_56delAGCAGCCTGGGCAACCCGCCGCCGCC; S11Afs*91

PubMed Link: 35794096

Variant Present in the following documents:

• 41467_2022_31355_MOESM5_ESM.xlsx, sheet 2

View BVdb publication page

---

Comprehensive genomic and tumour immune profiling reveals potential therapeutic targets in malignant pleural mesothelioma.

Genome Medicine

Creaney, Jenette J; Patch, Ann-Marie AM; Addala, Venkateswar V; Sneddon, Sophie A SA; Nones, Katia K; Dick, Ian M IM; Lee, Y C Gary YCG; Newell, Felicity F; Rouse, Ebony J EJ; Naeini, Marjan M MM; Kondrashova, Olga O; Lakis, Vanessa V; Nakas, Apostolos A; Waller, David D; Sharkey, Annabel A; Mukhopadhyay, Pamela P; Kazakoff, Stephen H SH; Koufariotis, Lambros T LT; Davidson, Aimee L AL; Ramarao-Milne, Priya P; Holmes, Oliver O; Xu, Qinying Q; Leonard, Conrad C; Wood, Scott S; Grimmond, Sean M SM; Bueno, Raphael R; Fennell, Dean A DA; Pearson, John V JV; Robinson, Bruce W BW; Waddell, Nicola N

Publication Date: 2022-05-30

Variant appearance in text: ARID1A: 19_44delCCCGCCGCCGCCAGCAGCCTGGGCAA

PubMed Link: 35637530

Variant Present in the following documents:

• 13073_2022_1060_MOESM4_ESM.xlsx, sheet 1

View BVdb publication page

---

CDKN2A loss-of-function predicts immunotherapy resistance in non-small cell lung cancer.

Scientific Reports

Gutiontov, Stanley I SI; Turchan, William Tyler WT; Spurr, Liam F LF; Rouhani, Sherin J SJ; Chervin, Carolina Soto CS; Steinhardt, George G; Lager, Angela M AM; Wanjari, Pankhuri P; Malik, Renuka R; Connell, Philip P PP; Chmura, Steven J SJ; Juloori, Aditya A; Hoffman, Philip C PC; Ferguson, Mark K MK; Donington, Jessica S JS; Patel, Jyoti D JD; Vokes, Everett E EE; Weichselbaum, Ralph R RR; Bestvina, Christine M CM; Segal, Jeremy P JP; Pitroda, Sean P SP

Publication Date: 2021-10-08

Variant appearance in text: ARID1A: 31_56del; S11Afs*91

PubMed Link: 34625620

Variant Present in the following documents:

• 41598_2021_99524_MOESM2_ESM.xlsx, sheet 2

View BVdb publication page

---

Genetic alteration of Chinese patients with rectal mucosal melanoma.

Bmc Cancer

Li, Huan H; Yang, Lujing L; Lai, Yumei Y; Wang, Xintong X; Han, Xinyin X; Liu, Siyao S; Wang, Dongliang D; Li, Xiaojuan X; Hu, Nana N; Kong, Yan Y; Si, Lu L; Li, Zhongwu Z

Publication Date: 2021-05-27

Variant appearance in text: ARID1A: 19_44del; S11fs

PubMed Link: 34044811

Variant Present in the following documents:

• 12885_2021_8383_MOESM1_ESM.xlsx, sheet 1

View BVdb publication page

---

Molecular screening and clinicopathologic characteristics of Lynch-like syndrome in a Chinese colorectal cancer cohort.

American Journal Of Cancer Research

Xu, Hai-Xia HX; Zhu, Ping P; Zheng, Yan-Ying YY; Zhang, Xiang X; Chen, Yi-Qi YQ; Qiao, Li-Chao LC; Zhang, Yi-Fen YF; Jiang, Feng F; Li, You-Ran YR; Chen, Hong-Jin HJ; Chen, Yu-Gen YG; Gu, Yun-Fei YF; Yang, Bo-Lin BL

Publication Date: 2020

Variant appearance in text: ARID1A: 19_44delCCCGCCGCCGCCAGCAGCCTGGGCAA

PubMed Link: 33294277

Variant Present in the following documents:

• Main text

View BVdb publication page

---

Sources of discordance among germ-line variant classifications in ClinVar.

Genetics In Medicine : Official Journal Of The American College Of Medical Genetics

Yang, Shan S; Lincoln, Stephen E SE; Kobayashi, Yuya Y; Nykamp, Keith K; Nussbaum, Robert L RL; Topper, Scott S

Publication Date: 2017-10

Variant appearance in text: ARID1A: 31_56del; Ser11Alafs

PubMed Link: 28569743

Variant Present in the following documents:

• gim201760x7.xlsx, sheet 2

View BVdb publication page

---

Integrating Genomics Into Clinical Pediatric Oncology Using the Molecular Tumor Board at the Memorial Sloan Kettering Cancer Center.

Pediatric Blood & Cancer

Ortiz, Michael V MV; Kobos, Rachel R; Walsh, Michael M; Slotkin, Emily K EK; Roberts, Stephen S; Berger, Michael F MF; Hameed, Meera M; Solit, David D; Ladanyi, Marc M; Shukla, Neerav N; Kentsis, Alex A

Publication Date: 2016-08

Variant appearance in text: ARID1A: 31_56del

PubMed Link: 27082517

Variant Present in the following documents:

• Main text

View BVdb publication page

---