Network expansion of genetic associations defines a pleiotropy map of human cell biology.
Nature Genetics
Barrio-Hernandez, Inigo I; Schwartzentruber, Jeremy J; Shrivastava, Anjali A; Del-Toro, Noemi N; Gonzalez, Asier A; Zhang, Qian Q; Mountjoy, Edward E; Suveges, Daniel D; Ochoa, David D; Ghoussaini, Maya M; Bradley, Glyn G; Hermjakob, Henning H; Orchard, Sandra S; Dunham, Ian I; Anderson, Carl A CA; Porras, Pablo P; Beltrao, Pedro P
Publication Date: 2023-02-23
Variant appearance in text: ARID1A: 921_940del; Tyr308fs
Molecular landscape of TP53 mutations in breast cancer and their utility for predicting the response to HER-targeted therapy in HER2 amplification-positive and HER2 mutation-positive amplification-negative patients.
Rearrangement-mediated cis-regulatory alterations in advanced patient tumors reveal interactions with therapy.
Cell Reports
Zhang, Yiqun Y; Chen, Fengju F; Pleasance, Erin E; Williamson, Laura L; Grisdale, Cameron J CJ; Titmuss, Emma E; Laskin, Janessa J; Jones, Steven J M SJM; Cortes-Ciriano, Isidro I; Marra, Marco A MA; Creighton, Chad J CJ
Publication Date: 2021-11-16
Variant appearance in text: ARID1A: 921_940delCTACCAGGGCTACCCCGGGG