Publications:

Network expansion of genetic associations defines a pleiotropy map of human cell biology.

Nature Genetics

Barrio-Hernandez, Inigo I; Schwartzentruber, Jeremy J; Shrivastava, Anjali A; Del-Toro, Noemi N; Gonzalez, Asier A; Zhang, Qian Q; Mountjoy, Edward E; Suveges, Daniel D; Ochoa, David D; Ghoussaini, Maya M; Bradley, Glyn G; Hermjakob, Henning H; Orchard, Sandra S; Dunham, Ian I; Anderson, Carl A CA; Porras, Pablo P; Beltrao, Pedro P

Publication Date: 2023-02-23

Variant appearance in text: ARID1A: 921_940del; Tyr308fs

PubMed Link: 36823319

Variant Present in the following documents:

• 41588_2023_1327_MOESM4_ESM.xlsx, sheet 6

View BVdb publication page

Molecular landscape of TP53 mutations in breast cancer and their utility for predicting the response to HER-targeted therapy in HER2 amplification-positive and HER2 mutation-positive amplification-negative patients.

Cancer Medicine

Liu, Binliang B; Yi, Zongbi Z; Guan, Yanfang Y; Ouyang, Quchang Q; Li, Chunxiao C; Guan, Xiuwen X; Lv, Dan D; Li, Lixi L; Zhai, Jingtong J; Qian, Haili H; Xu, Binghe B; Ma, Fei F; Zeng, Yixin Y

Publication Date: 2022-07

Variant appearance in text: ARID1A: 921_940delCTACCAGGGCTACCCCGGGG; Y308Rfs*85

PubMed Link: 35393784

Variant Present in the following documents:

• CAM4-11-2767-s001.xlsx, sheet 1

View BVdb publication page

Rearrangement-mediated cis-regulatory alterations in advanced patient tumors reveal interactions with therapy.

Cell Reports

Zhang, Yiqun Y; Chen, Fengju F; Pleasance, Erin E; Williamson, Laura L; Grisdale, Cameron J CJ; Titmuss, Emma E; Laskin, Janessa J; Jones, Steven J M SJM; Cortes-Ciriano, Isidro I; Marra, Marco A MA; Creighton, Chad J CJ

Publication Date: 2021-11-16

Variant appearance in text: ARID1A: 921_940delCTACCAGGGCTACCCCGGGG

PubMed Link: 34788622

Variant Present in the following documents:

• NIHMS1757901-supplement-2.xlsx, sheet 3

View BVdb publication page

Pan-cancer circulating tumor DNA detection in over 10,000 Chinese patients.

Nature Communications

Zhang, Yongliang Y; Yao, Yu Y; Xu, Yaping Y; Li, Lifeng L; Gong, Yan Y; Zhang, Kai K; Zhang, Meng M; Guan, Yanfang Y; Chang, Lianpeng L; Xia, Xuefeng X; Li, Lin L; Jia, Shuqin S; Zeng, Qiang Q

Publication Date: 2021-01-04

Variant appearance in text: ARID1A: 921_940delCTACCAGGGCTACCCCGGGG; Y308Rfs*85

PubMed Link: 33397889

Variant Present in the following documents:

• 41467_2020_20162_MOESM6_ESM.xlsx, sheet 1

View BVdb publication page

Molecular landscape and efficacy of HER2-targeted therapy in patients with HER2-mutated metastatic breast cancer.

Npj Breast Cancer

Yi, Zongbi Z; Rong, Guohua G; Guan, Yanfang Y; Li, Jin J; Chang, Lianpeng L; Li, Hui H; Liu, Binliang B; Wang, Wenna W; Guan, Xiuwen X; Ouyang, Quchang Q; Li, Lixi L; Zhai, Jingtong J; Li, Chunxiao C; Li, Lifeng L; Xia, Xuefeng X; Yang, Ling L; Qian, Haili H; Yi, Xin X; Xu, Binghe B; Ma, Fei F

Publication Date: 2020

Variant appearance in text: ARID1A: 921_940delCTACCAGGGCTACCCCGGGG; Y308Rfs*85

PubMed Link: 33145402

Variant Present in the following documents:

• 41523_2020_201_MOESM2_ESM.xlsx, sheet 1

View BVdb publication page