Publications:

Novel temporal and spatial patterns of metastatic colonization from breast cancer rapid-autopsy tumor biopsies.

Genome Medicine

Huang, Xiaomeng X; Qiao, Yi Y; Brady, Samuel W SW; Factor, Rachel E RE; Downs-Kelly, Erinn E; Farrell, Andrew A; McQuerry, Jasmine A JA; Shrestha, Gajendra G; Jenkins, David D; Johnson, W Evan WE; Cohen, Adam L AL; Bild, Andrea H AH; Marth, Gabor T GT

Publication Date: 2021-10-28

Variant appearance in text: PTEN: 676_697delTCCTCCAATTCAGGACCCACAC; S226fs

PubMed Link: 34711268

Variant Present in the following documents:

• Main text
• 13073_2021_989_MOESM2_ESM.xlsx, sheet 8
• 13073_2021_Article_989.pdf

View BVdb publication page