Novel temporal and spatial patterns of metastatic colonization from breast cancer rapid-autopsy tumor biopsies.
Genome Medicine
Huang, Xiaomeng X; Qiao, Yi Y; Brady, Samuel W SW; Factor, Rachel E RE; Downs-Kelly, Erinn E; Farrell, Andrew A; McQuerry, Jasmine A JA; Shrestha, Gajendra G; Jenkins, David D; Johnson, W Evan WE; Cohen, Adam L AL; Bild, Andrea H AH; Marth, Gabor T GT
Publication Date: 2021-10-28
Variant appearance in text: PTEN: 676_697delTCCTCCAATTCAGGACCCACAC; S226fs