Publications:

---

Evaluation of in silico pathogenicity prediction tools for the classification of small in-frame indels.

Bmc Medical Genomics

Cannon, S S; Williams, M M; Gunning, A C AC; Wright, C F CF

Publication Date: 2023-02-28

Variant appearance in text: SMPD1: 107_130del; Val36_Leu43del

PubMed Link: 36855133

Variant Present in the following documents:

• 12920_2023_1454_MOESM2_ESM.xlsx, sheet 1

View BVdb publication page

---

Integrated Whole-Exome and Transcriptome Sequencing Indicated Dysregulation of Cholesterol Metabolism in Eyelid Sebaceous Gland Carcinoma.

Translational Vision Science & Technology

Wang, Yuchuan Y; Li, Jun J; Hao, Peng P; Li, Jing J; Han, Ruifang R; Lin, Jinyong J; Li, Xuan X

Publication Date: 2023-02-01

Variant appearance in text: SMPD1: 103_126del

PubMed Link: 36735267

Variant Present in the following documents:

• tvst-12-2-4_s001.xls, sheet 8

View BVdb publication page

---

The Immune Landscape of Chinese Head and Neck Adenoid Cystic Carcinoma and Clinical Implication.

Frontiers In Immunology

Dou, Shengjin S; Li, Rongrong R; He, Ning N; Zhang, Menghuan M; Jiang, Wen W; Ye, Lulu L; Yang, Yining Y; Zhao, Guodong G; Yang, Yadong Y; Li, Jiang J; Chen, Di D; Zhu, Guopei G

Publication Date: 2021

Variant appearance in text: SMPD1: 107_130del; Val36_Leu43del

PubMed Link: 34552580

Variant Present in the following documents:

• DataSheet_3.xlsx, sheet 2

View BVdb publication page

---

Identification of KRAS G12V associated clonal neoantigens and immune microenvironment in long-term survival of pancreatic adenocarcinoma.

Cancer Immunology, Immunotherapy : Cii

Wang, Chao C; Shi, Min M; Zhang, Lei L; Ji, Jun J; Xie, Ruyan R; Wu, Chao C; Guo, Xianchao X; Yang, Ying Y; Zhou, Wei W; Peng, Chenhong C; Zhang, Henghui H; Yuan, Fei F; Zhang, Jun J

Publication Date: 2021-07-13

Variant appearance in text: SMPD1: 103_126delCTGGTGCTGGCGCTGGCGCTGGCG

PubMed Link: 34255132

Variant Present in the following documents:

• 262_2021_3012_MOESM1_ESM.xlsx, sheet 1

View BVdb publication page

---

Identification of KRAS G12V associated clonal neoantigens and immune microenvironment in long-term survival of pancreatic adenocarcinoma.

Cancer Immunology, Immunotherapy : Cii

Wang, Chao C; Shi, Min M; Zhang, Lei L; Ji, Jun J; Xie, Ruyan R; Wu, Chao C; Guo, Xianchao X; Yang, Ying Y; Zhou, Wei W; Peng, Chenhong C; Zhang, Henghui H; Yuan, Fei F; Zhang, Jun J

Publication Date: 2022-02

Variant appearance in text: SMPD1: 103_126delCTGGTGCTGGCGCTGGCGCTGGCG

PubMed Link: 34255132

Variant Present in the following documents:

• 262_2021_3012_MOESM1_ESM.xlsx, sheet 1

View BVdb publication page

---

Integrative multiplatform molecular profiling of benign prostatic hyperplasia identifies distinct subtypes.

Nature Communications

Liu, Deli D; Shoag, Jonathan E JE; Poliak, Daniel D; Goueli, Ramy S RS; Ravikumar, Vaishali V; Redmond, David D; Vosoughi, Aram A; Fontugne, Jacqueline J; Pan, Heng H; Lee, Daniel D; Thomas, Domonique D; Salari, Keyan K; Wang, Zongwei Z; Romanel, Alessandro A; Te, Alexis A; Lee, Richard R; Chughtai, Bilal B; Olumi, Aria F AF; Mosquera, Juan Miguel JM; Demichelis, Francesca F; Elemento, Olivier O; Rubin, Mark A MA; Sboner, Andrea A; Barbieri, Christopher E CE

Publication Date: 2020-04-24

Variant appearance in text: SMPD1: 103_126del

PubMed Link: 32332823

Variant Present in the following documents:

• 41467_2020_15913_MOESM6_ESM.xlsx, sheet 1

View BVdb publication page

---

A Landscape of Pharmacogenomic Interactions in Cancer.

Cell

Iorio, Francesco F; Knijnenburg, Theo A TA; Vis, Daniel J DJ; Bignell, Graham R GR; Menden, Michael P MP; Schubert, Michael M; Aben, Nanne N; Gonçalves, Emanuel E; Barthorpe, Syd S; Lightfoot, Howard H; Cokelaer, Thomas T; Greninger, Patricia P; van Dyk, Ewald E; Chang, Han H; de Silva, Heshani H; Heyn, Holger H; Deng, Xianming X; Egan, Regina K RK; Liu, Qingsong Q; Mironenko, Tatiana T; Mitropoulos, Xeni X; Richardson, Laura L; Wang, Jinhua J; Zhang, Tinghu T; Moran, Sebastian S; Sayols, Sergi S; Soleimani, Maryam M; Tamborero, David D; Lopez-Bigas, Nuria N; Ross-Macdonald, Petra P; Esteller, Manel M; Gray, Nathanael S NS; Haber, Daniel A DA; Stratton, Michael R MR; Benes, Cyril H CH; Wessels, Lodewyk F A LFA; Saez-Rodriguez, Julio J; McDermott, Ultan U; Garnett, Mathew J MJ

Publication Date: 2016-07-28

Variant appearance in text: SMPD1: 103_126del; V36_L43del

PubMed Link: 27397505

Variant Present in the following documents:

• mmc3.xlsx, sheet 3

View BVdb publication page

---