KMT2D c.1868_1894del ;(p.A623_E631del)

Variant ID: 12-49445571-TCCTCAGGTGGTGGGGACAGGCGTGATG-T

NM_003482.3(KMT2D):c.1868_1894del;(p.A623_E631del)

This variant was identified in 2 publications

View GRCh38 version.




Publications:


A genetically defined signature of responsiveness to erlotinib in early-stage pancreatic cancer patients: Results from the CONKO-005 trial.

Ebiomedicine
Hoyer, K K; Hablesreiter, R R; Inoue, Y Y; Yoshida, K K; Briest, F F; Christen, F F; Kakiuchi, N N; Yoshizato, T T; Shiozawa, Y Y; Shiraishi, Y Y; Striefler, J K JK; Bischoff, S S; Lohneis, P P; Putter, H H; Blau, O O; Keilholz, U U; Bullinger, L L; Pelzer, U U; Hummel, M M; Riess, H H; Ogawa, S S; Sinn, M M; Damm, F F
Publication Date: 2021-04

Variant appearance in text: KMT2D: 1868_1894del
PubMed Link: 33862582
Variant Present in the following documents:
  • mmc3.xlsx, sheet 2
View BVdb publication page



Epigenomic and genomic analysis of transcriptome modulation in skin cutaneous melanoma.

Aging
Chen, Wuzhen W; Cheng, Pu P; Jiang, Jingxin J; Ren, Yunqing Y; Wu, Dang D; Xue, Dan D
Publication Date: 2020-07-07

Variant appearance in text: KMT2D: 1868_1894delCATCACGCCTGTCCCCACCACCTGAGG
PubMed Link: 32639949
Variant Present in the following documents:
  • aging-12-103115-s013..xlsx, sheet 1
View BVdb publication page