Publications:

Rucaparib Monotherapy in Patients With Pancreatic Cancer and a Known Deleterious BRCA Mutation.

Jco Precision Oncology

Shroff, Rachna T RT; Hendifar, Andrew A; McWilliams, Robert R RR; Geva, Ravit R; Epelbaum, Ron R; Rolfe, Lindsey L; Goble, Sandra S; Lin, Kevin K KK; Biankin, Andrew V AV; Giordano, Heidi H; Vonderheide, Robert H RH; Domchek, Susan M SM

Publication Date: 2018

Variant appearance in text: BRCA2: 1355_1380delTACCAAAATCAGAGAAGCCATTAAAT; L452fs

PubMed Link: 30051098

Variant Present in the following documents:

• Main text

View BVdb publication page