Publications:

Molecular Genetic Diagnosis of Omani Patients With Inherited Cystic Kidney Disease.

Kidney International Reports

Al Alawi, Intisar I; Al Salmi, Issa I; Al Rahbi, Fatma F; Al Riyami, Mohamed M; Al Kalbani, Naifain N; Al Ghaithi, Badria B; Al Mawali, Adhra A; Sayer, John A JA

Publication Date: 2019-12

Variant appearance in text: PKD1: 12604_12631delGGCCGGCTGGGGACAAGGTGTGAGCCTG; Gly4202fs

PubMed Link: 31844813

Variant Present in the following documents:

• Main text

View BVdb publication page

Identification of gene mutations in autosomal dominant polycystic kidney disease through targeted resequencing.

Journal Of The American Society Of Nephrology : Jasn

Rossetti, Sandro S; Hopp, Katharina K; Sikkink, Robert A RA; Sundsbak, Jamie L JL; Lee, Yean Kit YK; Kubly, Vickie V; Eckloff, Bruce W BW; Ward, Christopher J CJ; Winearls, Christopher G CG; Torres, Vicente E VE; Harris, Peter C PC

Publication Date: 2012-05

Variant appearance in text: PKD1: 12604_12631delGGCCGGCTGGGGACAAGGTGTGAGCCTG

PubMed Link: 22383692

Variant Present in the following documents:

• Main text

View BVdb publication page