Publications:

Targeted genomic analysis of cutaneous T cell lymphomas identifies a subset with aggressive clinicopathological features.

Blood Cancer Journal

Argyropoulos, Kimon V KV; Pulitzer, Melissa M; Maura, Francesco F; Mohanty, Abhinita A; Mondello, Patrizia P; Horwitz, Steven M SM; Myskowski, Patricia P; Moskowitz, Alison A; Dogan, Ahmet A; Querfeld, Christiane C; Rapaport, Franck F; Siakantaris, Marina M; Louis, Peter C PC; Galasso, Natasha N; van den Brink, Marcel R M MRM; Palomba, M Lia ML

Publication Date: 2020-11-09

Variant appearance in text: TP53: 628_662delAACACTTTTCGACATAGTGTGGTGGTGCCCTATGA; N210fs

PubMed Link: 33168809

Variant Present in the following documents:

• 41408_2020_380_MOESM3_ESM.xlsx, sheet 1

View BVdb publication page