Publications:

---

Structural and Dynamic Differences between Calreticulin Mutants Associated with Essential Thrombocythemia.

Biomolecules

Radjasandirane, Ragousandirane R; de Brevern, Alexandre G AG

Publication Date: 2023-03-10

Variant appearance in text: CALR: 1092_1143del; L367Tfs*46

PubMed Link: 36979444

Variant Present in the following documents:

• Main text
• biomolecules-13-00509.pdf

View BVdb publication page

---

Network expansion of genetic associations defines a pleiotropy map of human cell biology.

Nature Genetics

Barrio-Hernandez, Inigo I; Schwartzentruber, Jeremy J; Shrivastava, Anjali A; Del-Toro, Noemi N; Gonzalez, Asier A; Zhang, Qian Q; Mountjoy, Edward E; Suveges, Daniel D; Ochoa, David D; Ghoussaini, Maya M; Bradley, Glyn G; Hermjakob, Henning H; Orchard, Sandra S; Dunham, Ian I; Anderson, Carl A CA; Porras, Pablo P; Beltrao, Pedro P

Publication Date: 2023-02-23

Variant appearance in text: CALR: 1092_1143del; Leu367Thrfs

PubMed Link: 36823319

Variant Present in the following documents:

• 41588_2023_1327_MOESM4_ESM.xlsx, sheet 6

View BVdb publication page

---

Essential Thrombocythemia: One-Center Data in a Changing Disease.

Medicina (Kaunas, Lithuania)

Pirciulescu, Nicoleta N; Gaman, Mihnea-Alexandru MA; Mihailescu, Marina M; Constantin, Cristina C; Dragomir, Mihaela M; Dobrea, Camelia C; Costache, Simona S; Ursuleac, Iulia I; Coriu, Daniel D; Crisan, Ana Manuela AM

Publication Date: 2022-12-06

Variant appearance in text: CALR: 1092_1143del

PubMed Link: 36557000

Variant Present in the following documents:

• Main text
• medicina-58-01798.pdf

View BVdb publication page

---

Transcriptome-based molecular subtypes and differentiation hierarchies improve the classification framework of acute myeloid leukemia.

Proceedings Of The National Academy Of Sciences Of The United States Of America

Cheng, Wen-Yan WY; Li, Jian-Feng JF; Zhu, Yong-Mei YM; Lin, Xiang-Jie XJ; Wen, Li-Jun LJ; Zhang, Fan F; Zhang, Yu-Liang YL; Zhao, Ming M; Fang, Hai H; Wang, Sheng-Yue SY; Lin, Xiao-Jing XJ; Qiao, Niu N; Yin, Wei W; Zhang, Jia-Nan JN; Dai, Yu-Ting YT; Jiang, Lu L; Sun, Xiao-Jian XJ; Xu, Yi Y; Zhang, Tong-Tong TT; Chen, Su-Ning SN; Zhu, Hong-Hu HH; Chen, Zhu Z; Jin, Jie J; Wu, De-Pei DP; Shen, Yang Y; Chen, Sai-Juan SJ

Publication Date: 2022-12-06

Variant appearance in text: CALR: 1092_1143del

PubMed Link: 36442087

Variant Present in the following documents:

• pnas.2211429119.sd02.xlsx, sheet 1

View BVdb publication page

---

Effects of CALR-Mutant Type and Burden on the Phenotype of Myeloproliferative Neoplasms.

Diagnostics (Basel, Switzerland)

Kim, Hyun-Young HY; Han, Yujin Y; Jang, Jun Ho JH; Jung, Chul Won CW; Kim, Sun-Hee SH; Kim, Hee-Jin HJ

Publication Date: 2022-10-23

Variant appearance in text: CALR: 1099_1150del; Leu367Thrfs*46

PubMed Link: 36359414

Variant Present in the following documents:

• Main text
• diagnostics-12-02570.pdf

View BVdb publication page

---

Essential thrombocythaemia progression to the fibrotic phase is associated with a decrease in JAK2 and PDL1 levels.

Annals Of Hematology

Lewandowski, Krzysztof K; Kanduła, Zuzanna Z; Gniot, Michał M; Paczkowska, Edyta E; Nawrocka, Paulina Maria PM; Wojtaszewska, Marzena M; Janowski, Michał M; Mariak, Magdalena M; Handschuh, Luiza L; Kozlowski, Piotr P

Publication Date: 2022-12

Variant appearance in text: CALR: 1099_1150del; Leu367Thrfs*46

PubMed Link: 36266510

Variant Present in the following documents:

• Main text
• 277_2022_Article_5001.pdf

View BVdb publication page

---

Age-dependent association of clonal hematopoiesis with COVID-19 mortality in patients over 60 years.

Geroscience

Del Pozo-Valero, Marta M; Corton, Marta M; López-Rodríguez, Rosario R; Mahillo-Fernández, Ignacio I; Ruiz-Hornillos, Javier J; Minguez, Pablo P; Villaverde, Cristina C; Pérez-Tomás, María Elena ME; Barreda-Sánchez, María M; Mancebo, Esther E; , ; Paz-Artal, Estela E; Guillén-Navarro, Encarna E; Almoguera, Berta B; Ayuso, Carmen C

Publication Date: 2022-10-03

Variant appearance in text: CALR: 1099_1150del; Leu367Thrfs

PubMed Link: 36184726

Variant Present in the following documents:

• 11357_2022_666_MOESM1_ESM.xlsx, sheet 2

View BVdb publication page

---

Distinguishing STAT3/STAT5B Mutated Large Granular Lymphocyte Leukemia from Myeloid Neoplasms by Genetic Profiling.

Blood Advances

Kavesh, Mark M; Mohebnasab, Maedeh M; Angel, Marcela Riveros MR; Xie, Wei W; Raess, Philipp W PW; Cui, Wei W; Press, Richard D RD; Yang, Guang G; Li, Peng P

Publication Date: 2022-08-08

Variant appearance in text: CALR: 1099_1150del; L367fs

PubMed Link: 35939786

Variant Present in the following documents:

• BLOODA_ADV-2022-008192-mmc1.pdf

View BVdb publication page

---

Mutational spectrum and prognosis in Chinese patients with prefibrotic primary myelofibrosis.

Ejhaem

Cheng, Chi-Keung CK; Lai, Jennifer W Y JWY; Yung, Yuk-Lin YL; Chan, Hoi-Yun HY; Wong, Raymond S M RSM; Chan, Natalie P H NPH; Cheung, Joyce S JS; Luo, Xi X; Pitts, Herbert-Augustus HA; Ng, Margaret H L MHL

Publication Date: 2022-02

Variant appearance in text: CALR: 1099_1150del; L367Tfs*46

PubMed Link: 35846205

Variant Present in the following documents:

• JHA2-3-184-s002.xlsx, sheet 1

View BVdb publication page

---

Hematological relevance of JAK2 V617F and calreticulin mutations in Tunisian patients with essential thrombocythemia.

Journal Of Clinical Laboratory Analysis

Abdelghani, Maroua M; Hammami, Haifa H; Zidi, Wiem W; Amouri, Hassiba H; Othmen, Hind Ben Hadj HBH; Farrah, Ahlem A; Menif, Samia S

Publication Date: 2022-08

Variant appearance in text: CALR: 1092_1143del

PubMed Link: 35754115

Variant Present in the following documents:

• Main text
• JCLA-36-e24522.pdf

View BVdb publication page

---

Feasibility and clinical utility of comprehensive genomic profiling of hematological malignancies.

Cancer Science

Fukuhara, Suguru S; Oshikawa-Kumade, Yuji Y; Kogure, Yasunori Y; Shingaki, Sumito S; Kariyazono, Hirokazu H; Kikukawa, Yoshiya Y; Koya, Junji J; Saito, Yuki Y; Tabata, Mariko M; Yoshifuji, Kota K; Mizuno, Kota K; Miyagi-Maeshima, Akiko A; Matsushita, Hiromichi H; Sugiyama, Masanaka M; Ogawa, Chitose C; Inamoto, Yoshihiro Y; Fukuda, Takahiro T; Sugano, Masato M; Yamauchi, Nobuhiko N; Minami, Yosuke Y; Hirata, Makoto M; Yoshida, Teruhiko T; Kohno, Takashi T; Kohsaka, Shinji S; Mano, Hiroyuki H; Shiraishi, Yuichi Y; Ogawa, Seishi S; Izutsu, Koji K; Kataoka, Keisuke K

Publication Date: 2022-08

Variant appearance in text: CALR: 1092_1143del

PubMed Link: 35579198

Variant Present in the following documents:

• CAS-113-2763-s003.xlsx, sheet 10

View BVdb publication page

---

Direct comparison of circulating tumor DNA sequencing assays with targeted large gene panels.

Plos One

Yu, Lizhi L; Lopez, Gonzalo G; Rassa, John J; Wang, Yixin Y; Basavanhally, Tara T; Browne, Andrew A; Huang, Chang-Pin CP; Dorsey, Lauren L; Jen, Jin J; Hersey, Sarah S

Publication Date: 2022

Variant appearance in text: CALR: 1092_1143del

PubMed Link: 35482763

Variant Present in the following documents:

• Main text
• pone.0266889.pdf

View BVdb publication page

---

Technological Advances: CEBPA and FLT3 Internal Tandem Duplication Mutations Can be Reliably Detected by Next Generation Sequencing.

Genes

Akabari, Ratilal R; Qin, Dahui D; Hussaini, Mohammad M

Publication Date: 2022-04-01

Variant appearance in text: CALR: 1099_1150del

PubMed Link: 35456436

Variant Present in the following documents:

• Main text
• genes-13-00630.pdf

View BVdb publication page

---

Tool evaluation for the detection of variably sized indels from next generation whole genome and targeted sequencing data.

Plos Computational Biology

Wang, Ning N; Lysenkov, Vladislav V; Orte, Katri K; Kairisto, Veli V; Aakko, Juhani J; Khan, Sofia S; Elo, Laura L LL

Publication Date: 2022-02

Variant appearance in text: CALR: 1099_1150del

PubMed Link: 35176018

Variant Present in the following documents:

• pcbi.1009269.s014.xlsx, sheet 1

View BVdb publication page

---

Targeting human CALR-mutated MPN progenitors with a neoepitope-directed monoclonal antibody.

Embo Reports

Tvorogov, Denis D; Thompson-Peach, Chloe A L CAL; Foßelteder, Johannes J; Dottore, Mara M; Stomski, Frank F; Onnesha, Suraiya A SA; Lim, Kelly K; Moretti, Paul A B PAB; Pitson, Stuart M SM; Ross, David M DM; Reinisch, Andreas A; Thomas, Daniel D; Lopez, Angel F AF

Publication Date: 2022-04-05

Variant appearance in text: CALR: 1099_1150del; Leu367Thrfs*46

PubMed Link: 35156745

Variant Present in the following documents:

• EMBR-23-e52904-s006.pdf

View BVdb publication page

---

Analysis of genetic variants in myeloproliferative neoplasms using a 22-gene next-generation sequencing panel.

Bmc Medical Genomics

Tan, Jaymi J; Chow, Yock Ping YP; Zainul Abidin, Norziha N; Chang, Kian Meng KM; Selvaratnam, Veena V; Tumian, Nor Rafeah NR; Poh, Yang Ming YM; Veerakumarasivam, Abhi A; Laffan, Michael Arthur MA; Wong, Chieh Lee CL

Publication Date: 2022-01-15

Variant appearance in text: CALR: 1092_1143del

PubMed Link: 35033063

Variant Present in the following documents:

• Main text
• 12920_2021_Article_1145.pdf

View BVdb publication page

---

Analysis of genetic variants in myeloproliferative neoplasms using a 22-gene next-generation sequencing panel.

Bmc Medical Genomics

Tan, Jaymi J; Chow, Yock Ping YP; Zainul Abidin, Norziha N; Chang, Kian Meng KM; Selvaratnam, Veena V; Tumian, Nor Rafeah NR; Poh, Yang Ming YM; Veerakumarasivam, Abhi A; Laffan, Michael Arthur MA; Wong, Chieh Lee CL

Publication Date: 2022-01-15

Variant appearance in text: CALR: 1092_1143del

PubMed Link: 35033063

Variant Present in the following documents:

• Main text
• 12920_2021_Article_1145.pdf

View BVdb publication page

---

Integration of Molecular Information in Risk Assessment of Patients with Myeloproliferative Neoplasms.

Cells

Loscocco, Giuseppe G GG; Coltro, Giacomo G; Guglielmelli, Paola P; Vannucchi, Alessandro M AM

Publication Date: 2021-08-02

Variant appearance in text: CALR: 1092_1143del

PubMed Link: 34440731

Variant Present in the following documents:

• Main text
• cells-10-01962.pdf

View BVdb publication page

---

Synoptic Diagnostics of Myeloproliferative Neoplasms: Morphology and Molecular Genetics.

Cancers

Nann, Dominik D; Fend, Falko F

Publication Date: 2021-07-14

Variant appearance in text: CALR: 1092_1143del

PubMed Link: 34298741

Variant Present in the following documents:

• Main text
• cancers-13-03528.pdf

View BVdb publication page

---

Disease modifying agents of myeloproliferative neoplasms: a review.

Blood Research

Lee, Sung-Eun SE

Publication Date: 2021-04-30

Variant appearance in text: CALR: 1092_1143del

PubMed Link: 33935032

Variant Present in the following documents:

• Main text

View BVdb publication page

---

Recurrent deletions in clonal hematopoiesis are driven by microhomology-mediated end joining.

Nature Communications

Feldman, Tzah T; Bercovich, Akhiad A; Moskovitz, Yoni Y; Chapal-Ilani, Noa N; Mitchell, Amanda A; Medeiros, Jessie J F JJF; Biezuner, Tamir T; Kaushansky, Nathali N; Minden, Mark D MD; Gupta, Vikas V; Milyavsky, Michael M; Livneh, Zvi Z; Tanay, Amos A; Shlush, Liran I LI

Publication Date: 2021-04-28

Variant appearance in text: CALR: 1092_1143del

PubMed Link: 33911081

Variant Present in the following documents:

• Main text

View BVdb publication page

---

Mutation Profile in BCR-ABL1-Negative Myeloproliferative Neoplasms: A Single-Center Experience From India.

Hematology/Oncology And Stem Cell Therapy

Maddali, Madhavi M; Kulkarni, Uday Prakash UP; Ravindra, Niveditha N; Arunachalam, Arun Kumar AK; Venkatraman, Arvind A; Lionel, Sharon S; Manipadam, Marie Therese MT; Devasia, Anup J AJ; Korula, Anu A; Fouzia, N A NA; Abraham, Aby A; Srivastava, Alok A; George, Biju B; Balasubramanian, Poonkuzhali P; Mathews, Vikram V

Publication Date: 2022-06-01

Variant appearance in text: CALR: 1099_1150del; L367Tfs*46

PubMed Link: 33789164

Variant Present in the following documents:

• EMS126285.pdf

View BVdb publication page

---

Myeloproliferative neoplasm-driving Calr frameshift promotes the development of pulmonary hypertension in mice.

Journal Of Hematology & Oncology

Minakawa, Keiji K; Yokokawa, Tetsuro T; Ueda, Koki K; Nakajima, Osamu O; Misaka, Tomofumi T; Kimishima, Yusuke Y; Wada, Kento K; Tomita, Yusuke Y; Miura, Saori S; Sato, Yuka Y; Mimura, Kosaku K; Sugimoto, Koichi K; Nakazato, Kazuhiko K; Nollet, Kenneth E KE; Ogawa, Kazuei K; Ikezoe, Takayuki T; Hashimoto, Yuko Y; Takeishi, Yasuchika Y; Ikeda, Kazuhiko K

Publication Date: 2021-03-30

Variant appearance in text: CALR: 1099_1150del; L367Tfs*46

PubMed Link: 33785036

Variant Present in the following documents:

• 13045_2021_1064_MOESM7_ESM.pdf

View BVdb publication page

---

Integration Analysis of JAK2 or RUNX1 Mutation With Bone Marrow Blast Can Improve Risk Stratification in the Patients With Lower Risk Myelodysplastic Syndrome.

Frontiers In Oncology

Fang, Ying Y; Guo, Juan J; Wu, Dong D; Wu, Ling-Yun LY; Song, Lu-Xi LX; Zhang, Zheng Z; Zhao, You-Shan YS; Chang, Chun-Kang CK

Publication Date: 2020

Variant appearance in text: CALR: 1092_1143del

PubMed Link: 33520721

Variant Present in the following documents:

• Table_2.xlsx, sheet 1

View BVdb publication page

---

Primary myelofibrosis with concurrent CALR and MPL mutations: A case report.

World Journal Of Clinical Cases

Zhou, Feng-Ping FP; Wang, Cheng-Cheng CC; Du, Hua-Ping HP; Cao, Shan-Bo SB; Zhang, Jin J

Publication Date: 2020-11-26

Variant appearance in text: CALR: 1092_1143del; L367Tfs*46

PubMed Link: 33344552

Variant Present in the following documents:

• Main text

View BVdb publication page

---

Impact of Mutational Profile on the Management of Myeloproliferative Neoplasms: A Short Review of the Emerging Data.

Oncotargets And Therapy

Loscocco, Giuseppe G GG; Guglielmelli, Paola P; Vannucchi, Alessandro M AM

Publication Date: 2020

Variant appearance in text: CALR: 1092_1143del

PubMed Link: 33293830

Variant Present in the following documents:

• Main text
• ott-13-12367.pdf

View BVdb publication page

---

Clinical performance and utility of a comprehensive next-generation sequencing DNA panel for the simultaneous analysis of variants, TMB and MSI for myeloid neoplasms.

Plos One

Sahajpal, Nikhil Shri NS; Mondal, Ashis K AK; Ananth, Sudha S; Njau, Allan A; Ahluwalia, Pankaj P; Jones, Kimya K; Ahluwalia, Meenakshi M; Okechukwu, Nwogbo N; Savage, Natasha M NM; Kota, Vamsi V; Rojiani, Amyn M AM; Kolhe, Ravindra R

Publication Date: 2020

Variant appearance in text: N/A

PubMed Link: 33075099

Variant Present in the following documents:

View BVdb publication page

---

Megakaryocytes, erythropoietic and granulopoietic cells express CAL2 antibody in myeloproliferative neoplasms carrying CALR gene mutations.

International Journal Of Experimental Pathology

Ali, Hebah H; Puccio, Ignazio I; Akarca, Ayse U AU; Bob, Roshanak R; Pomplun, Sabine S; Keong Wong, Wai W; Gupta, Rajeev R; Sekhar, Mallika M; Lambert, Jonathan J; Al-Masri, Hytham H; Stein, Harald H; Marafioti, Teresa T

Publication Date: 2021-02

Variant appearance in text: CALR: 1099_1150del; Leu367Thrfs*46

PubMed Link: 32929772

Variant Present in the following documents:

• Main text
• IEP-102-45.pdf

View BVdb publication page

---

Portal Thrombosis in Cirrhosis: Role of Thrombophilic Disorders.

Journal Of Clinical Medicine

Fortea, José Ignacio JI; Carrera, Inés García IG; Puente, Ángela Á; Cuadrado, Antonio A; Huelin, Patricia P; Tato, Carmen Álvarez CÁ; Fernández, Paloma Álvarez PÁ; Montes, María Del Rocío Pérez MDRP; Céspedes, Javier Nuñez JN; López, Ana Batlle AB; Sanchez, Francisco José González FJG; Hoyos, Marcos López ML; Crespo, Javier J; Fábrega, Emilio E

Publication Date: 2020-08-31

Variant appearance in text: CALR: 1092_1143del

PubMed Link: 32878264

Variant Present in the following documents:

• Main text

View BVdb publication page

---

Murine Models of Myelofibrosis.

Cancers

Jacquelin, Sebastien S; Kramer, Frederike F; Mullally, Ann A; Lane, Steven W SW

Publication Date: 2020-08-23

Variant appearance in text: CALR: 1092_1143del

PubMed Link: 32842500

Variant Present in the following documents:

• Main text
• cancers-12-02381.pdf

View BVdb publication page

---

STAT5 is Expressed in CD34+/CD38- Stem Cells and Serves as a Potential Molecular Target in Ph-Negative Myeloproliferative Neoplasms.

Cancers

Hadzijusufovic, Emir E; Keller, Alexandra A; Berger, Daniela D; Greiner, Georg G; Wingelhofer, Bettina B; Witzeneder, Nadine N; Ivanov, Daniel D; Pecnard, Emmanuel E; Nivarthi, Harini H; Schur, Florian K M FKM; Filik, Yüksel Y; Kornauth, Christoph C; Neubauer, Heidi A HA; Müllauer, Leonhard L; Tin, Gary G; Park, Jisung J; de Araujo, Elvin D ED; Gunning, Patrick T PT; Hoermann, Gregor G; Gouilleux, Fabrice F; Kralovics, Robert R; Moriggl, Richard R; Valent, Peter P

Publication Date: 2020-04-21

Variant appearance in text: CALR: 1099_1150del; Leu367Thrfs*46

PubMed Link: 32326377

Variant Present in the following documents:

• Main text
• cancers-12-01021.pdf

View BVdb publication page

---

Assessment of the clinical utility of four NGS panels in myeloid malignancies. Suggestions for NGS panel choice or design.

Plos One

Aguilera-Diaz, Almudena A; Vazquez, Iria I; Ariceta, Beñat B; Mañú, Amagoia A; Blasco-Iturri, Zuriñe Z; Palomino-Echeverría, Sara S; Larrayoz, María José MJ; García-Sanz, Ramón R; Prieto-Conde, María Isabel MI; Del Carmen Chillón, María M; Alfonso-Pierola, Ana A; Prosper, Felipe F; Fernandez-Mercado, Marta M; Calasanz, María José MJ

Publication Date: 2020

Variant appearance in text: CALR: 1099_1150del; Leu367Thrfs

PubMed Link: 31978184

Variant Present in the following documents:

• Main text
• pone.0227986.pdf

View BVdb publication page

---

Single-cell analysis based dissection of clonality in myelofibrosis.

Nature Communications

Mylonas, Elena E; Yoshida, Kenichi K; Frick, Mareike M; Hoyer, Kaja K; Christen, Friederike F; Kaeda, Jaspal J; Obenaus, Matthias M; Noerenberg, Daniel D; Hennch, Cornelius C; Chan, Willy W; Ochi, Yotaro Y; Shiraishi, Yuichi Y; Shiozawa, Yusuke Y; Zenz, Thorsten T; Oakes, Christopher C CC; Sawitzki, Birgit B; Schwarz, Michaela M; Bullinger, Lars L; le Coutre, Philipp P; Rose-Zerilli, Matthew J J MJJ; Ogawa, Seishi S; Damm, Frederik F

Publication Date: 2020-01-07

Variant appearance in text: CALR: 1092_1143del

PubMed Link: 31911629

Variant Present in the following documents:

• 41467_2019_13892_MOESM4_ESM.xlsx, sheet 7
• 41467_2019_13892_MOESM4_ESM.xlsx, sheet 6

View BVdb publication page

---

CALR mutations in a cohort of JAK2 V617F negative patients with suspected myeloproliferative neoplasms.

Scientific Reports

Belcic Mikic, Tanja T; Pajic, Tadej T; Sever, Matjaz M

Publication Date: 2019-12-27

Variant appearance in text: CALR: 1092_1143del; Leu367Thrfs*46

PubMed Link: 31882869

Variant Present in the following documents:

• Main text

View BVdb publication page

---

The Expression of Myeloproliferative Neoplasm-Associated Calreticulin Variants Depends on the Functionality of ER-Associated Degradation.

Cancers

Mansier, Olivier O; Prouzet-Mauléon, Valérie V; Jégou, Gwénaële G; Barroso, Kim K; Raymundo, Diana Pelizzari DP; Chauveau, Aurélie A; Dumas, Pierre-Yves PY; Lagarde, Valérie V; Turcq, Béatrice B; Pasquet, Jean-Max JM; Viallard, Jean-François JF; James, Chloé C; Praloran, Vincent V; Voutetakis, Konstantinos K; Chatziioannou, Aristotelis A; Mahon, François-Xavier FX; Chevet, Eric E; Lippert, Eric E

Publication Date: 2019-12-02

Variant appearance in text: CALR: 1099_1150del

PubMed Link: 31810292

Variant Present in the following documents:

• Main text

View BVdb publication page

---

Recent insights regarding the molecular basis of myeloproliferative neoplasms.

The Korean Journal Of Internal Medicine

Jang, Mi-Ae MA; Choi, Chul Won CW

Publication Date: 2020-01

Variant appearance in text: CALR: 1092_1143del

PubMed Link: 31778606

Variant Present in the following documents:

• Main text

View BVdb publication page

---

Imatinib Treatment of Chronic Myeloid Leukemia Reveals a Preexisting CALR-mutated Essential Thrombocythemia.

Hemasphere

Blouet, Anaïse A; Rousselet, Marie-Christine MC; Le Bris, Yannick Y; Ribourtout, Bénédicte B; Bouvier, Anne A; Cottin, Laurane L; Jouanneau-Courville, Rébecca R; Blanchet, Odile O; Ugo, Valérie V; Luque Paz, Damien D

Publication Date: 2018

Variant appearance in text: CALR: 1099_1150del

PubMed Link: 31723757

Variant Present in the following documents:

• Main text
• hs9-2-e29.pdf

View BVdb publication page

---

Clinical and Hematological Relevance of JAK2V617F, CALR, and MPL Mutations in Vietnamese Patients with Essential Thrombocythemia.

Asian Pacific Journal Of Cancer Prevention : Apjcp

Vu, Hoang Anh HA; Thao, Tran Thi TT; Dong, Cao Van CV; Vuong, Nguyen Lam NL; Chuong, Ho Quoc HQ; Van, Phan Nguyen Thanh PNT; Nghia, Huynh H; Binh, Nguyen Tan NT; Dung, Phu Chi PC; Xinh, Phan Thi PT

Publication Date: 2019-09-01

Variant appearance in text: CALR: 1099_1150del

PubMed Link: 31554376

Variant Present in the following documents:

• Main text
• APJCP-20-2775.pdf

View BVdb publication page

---

Detection of CALR Mutations Using High Resolution Melting Curve Analysis (HRM-A); Application on a Large Cohort of Greek ET and MF Patients.

Mediterranean Journal Of Hematology And Infectious Diseases

Giannopoulos, Andreas A; Rougkala, Niki N; Loupis, Theodoros T; Mantzourani, Marina M; Viniou, Nora-Athina NA; Variami, Eleni E; Vassilakopoulos, Theodoros P TP; Dryllis, George G; Kotsianidis, Ioannis I; Gougopoulou, Theodora T; Politou, Marianna M; Konstantopoulos, Kostas K; Vassilopoulos, George G

Publication Date: 2019

Variant appearance in text: CALR: 1092_1143del; L367fs

PubMed Link: 30671215

Variant Present in the following documents:

• Main text

View BVdb publication page

---

Splenic mass in a case of CALR-mutated essential thrombocythemia.

Clinical Case Reports

Imashuku, Shinsaku S; Kotani, Shinichi S; Hinami, Junsuke J; Nishimura, Keisuke K

Publication Date: 2018-11

Variant appearance in text: CALR: 1092_1143del

PubMed Link: 30455943

Variant Present in the following documents:

• Main text
• CCR3-6-2291.pdf

View BVdb publication page

---

Detection and characterization of homozygosity of mutated CALR by copy neutral loss of heterozygosity in myeloproliferative neoplasms among cases with high CALR mutation loads or with progressive disease.

Haematologica

Stengel, Anna A; Jeromin, Sabine S; Haferlach, Torsten T; Meggendorfer, Manja M; Kern, Wolfgang W; Haferlach, Claudia C

Publication Date: 2019-05

Variant appearance in text: CALR: 1099_1150del

PubMed Link: 30409794

Variant Present in the following documents:

• Main text

View BVdb publication page

---

Multiple Roles of Glycans in Hematological Malignancies.

Frontiers In Oncology

Pang, Xingchen X; Li, Hongjiao H; Guan, Feng F; Li, Xiang X

Publication Date: 2018

Variant appearance in text: CALR: 1092_1143del

PubMed Link: 30237983

Variant Present in the following documents:

• Main text
• fonc-08-00364.pdf

View BVdb publication page

---

appreci8: a pipeline for precise variant calling integrating 8 tools.

Bioinformatics (Oxford, England)

Sandmann, Sarah S; Karimi, Mohsen M; de Graaf, Aniek O AO; Rohde, Christian C; Göllner, Stefanie S; Varghese, Julian J; Ernsting, Jan J; Walldin, Gunilla G; van der Reijden, Bert A BA; Müller-Tidow, Carsten C; Malcovati, Luca L; Hellström-Lindberg, Eva E; Jansen, Joop H JH; Dugas, Martin M

Publication Date: 2018-12-15

Variant appearance in text: CALR: 1099_1150delCTTAAGGAGGAGGAAGAAGACAAGAAACGCAAAGAGGAGGAGGAGGCAGAGG; Leu367fs

PubMed Link: 29945233

Variant Present in the following documents:

• bty518_supplementary_data_s6.xlsx, sheet 2

View BVdb publication page

---

Novel molecular mechanism of cellular transformation by a mutant molecular chaperone in myeloproliferative neoplasms.

Cancer Science

Araki, Marito M; Komatsu, Norio N

Publication Date: 2017-10

Variant appearance in text: CALR: 1092_1143del

PubMed Link: 28741795

Variant Present in the following documents:

• Main text

View BVdb publication page

---

[Clinical significance of JAK2、CALR and MPL gene mutations in 1 648 Philadelphia chromosome negative myeloproliferative neoplasms patients from a single center].

Zhonghua Xue Ye Xue Za Zhi = Zhonghua Xueyexue Zazhi

Li, M Y MY; Chao, H Y HY; Sun, A N AN; Qiu, H Y HY; Jin, Z M ZM; Tang, X W XW; Han, Y Y; Fu, C C CC; Chen, S N SN; Wu, D P DP

Publication Date: 2017-04-14

Variant appearance in text: CALR: 1092_1143del

PubMed Link: 28468090

Variant Present in the following documents:

• Main text
• cjh-38-04-295.pdf

View BVdb publication page

---

Characterization and Prognosis Significance of JAK2 (V617F), MPL, and CALR Mutations in Philadelphia-Negative Myeloproliferative Neoplasms

Asian Pacific Journal Of Cancer Prevention : Apjcp

Singdong, Roongrudee R; Siriboonpiputtana, Teerapong T; Chareonsirisuthigul, Takol T; Kongruang, Adcharee A; Limsuwanachot, Nittaya N; Sirirat, Tanasan T; Chuncharunee, Suporn S; Rerkamnuaychoke, Budsaba B

Publication Date: 2016-10-01

Variant appearance in text: CALR: 1092_1143del

PubMed Link: 27892678

Variant Present in the following documents:

• Main text

View BVdb publication page

---