Genetic evaluation of cardiomyopathies in Qatar identifies enrichment of pathogenic sarcomere gene variants and possible founder disease mutations in the Arabs.
Molecular Genetics & Genomic Medicine
Al-Shafai, Kholoud N KN; Al-Hashemi, Mohammed M; Manickam, Chidambaram C; Musa, Rania R; Selvaraj, Senthil S; Syed, Najeeb N; Vempalli, Fazulur F; Ali, Muneera M; Yacoub, Magdi M; Estivill, Xavier X
Publication Date: 2021-07
Variant appearance in text: TTN: 34150_34170delGTTCTACCTGAAGAAGAGGAA; Val11384_Glu11390del
Genetic evaluation of cardiomyopathies in Qatar identifies enrichment of pathogenic sarcomere gene variants and possible founder disease mutations in the Arabs.
Molecular Genetics & Genomic Medicine
Al-Shafai, Kholoud N KN; Al-Hashemi, Mohammed M; Manickam, Chidambaram C; Musa, Rania R; Selvaraj, Senthil S; Syed, Najeeb N; Vempalli, Fazulur F; Ali, Muneera M; Yacoub, Magdi M; Estivill, Xavier X
Publication Date: 2021-07
Variant appearance in text: TTN: 34150_34170delGTTCTACCTGAAGAAGAGGAA; Val11384_Glu11390del