TTN c.34150_34170del ;(p.V11384_E11390del)

Variant ID: 2-179542468-TTTCCTCTTCTTCAGGTAGAAC-T

NM_001267550.1(TTN):c.34150_34170del;(p.V11384_E11390del)

This variant was identified in 1 publication

View GRCh38 version.




Publications:


Genetic evaluation of cardiomyopathies in Qatar identifies enrichment of pathogenic sarcomere gene variants and possible founder disease mutations in the Arabs.

Molecular Genetics & Genomic Medicine
Al-Shafai, Kholoud N KN; Al-Hashemi, Mohammed M; Manickam, Chidambaram C; Musa, Rania R; Selvaraj, Senthil S; Syed, Najeeb N; Vempalli, Fazulur F; Ali, Muneera M; Yacoub, Magdi M; Estivill, Xavier X
Publication Date: 2021-07

Variant appearance in text: TTN: 34150_34170delGTTCTACCTGAAGAAGAGGAA; Val11384_Glu11390del
PubMed Link: 34137518
Variant Present in the following documents:
  • MGG3-9-e1709-s003.xlsx, sheet 1
View BVdb publication page



Genetic evaluation of cardiomyopathies in Qatar identifies enrichment of pathogenic sarcomere gene variants and possible founder disease mutations in the Arabs.

Molecular Genetics & Genomic Medicine
Al-Shafai, Kholoud N KN; Al-Hashemi, Mohammed M; Manickam, Chidambaram C; Musa, Rania R; Selvaraj, Senthil S; Syed, Najeeb N; Vempalli, Fazulur F; Ali, Muneera M; Yacoub, Magdi M; Estivill, Xavier X
Publication Date: 2021-07

Variant appearance in text: TTN: 34150_34170delGTTCTACCTGAAGAAGAGGAA; Val11384_Glu11390del
PubMed Link: 34137518
Variant Present in the following documents:
  • MGG3-9-e1709-s003.xlsx, sheet 1
View BVdb publication page