Publications:

Genomic Landscape of RTK/RAS Pathway and Tumor Immune Infiltration as Prognostic Indicator of Lung Adenocarcinoma.

Frontiers In Oncology

Yin, Xiang-Qian XQ; Yin, Xue-Hui XH; Yu, Ya-Qin YQ; Xu, Lang L; Zhang, Mao M

Publication Date: 2022

Variant appearance in text: KIT: 1663_1713del; V555_I571del

PubMed Link: 35936718

Variant Present in the following documents:

• Table_4.xlsx, sheet 2

View BVdb publication page

Molecular landscape and therapeutic alterations in Asian soft-tissue sarcoma patients.

Cancer Medicine

Gan, Meifu M; Zhang, Chen C; Qiu, Liqing L; Wang, Yue Y; Bao, Hua H; Yu, Ruoying R; Liu, Rui R; Wu, Xue X; Shao, Yang Y; Hou, Peifeng P; Fei, Zhenglei Z

Publication Date: 2022-11

Variant appearance in text: KIT: 1664_1714delTACAGTGGAAGGTTGTTGAGGAGATAAATGGAAACAATTATGTTTACATAG; V555_I571del

PubMed Link: 35586877

Variant Present in the following documents:

• CAM4-11-4070-s004.xlsx, sheet 1

View BVdb publication page

Molecular Portrait of GISTs Associated With Clinicopathological Features: A Retrospective Study With Molecular Analysis by a Custom 9-Gene Targeted Next-Generation Sequencing Panel.

Frontiers In Genetics

Qian, Haoran H; Yan, Na N; Hu, Xiaotong X; Jiang, Junchang J; Cao, Zhengzheng Z; Shen, Dan D

Publication Date: 2022

Variant appearance in text: KIT: V555_I571del

PubMed Link: 35547262

Variant Present in the following documents:

• DataSheet1.xlsx, sheet 1

View BVdb publication page

Mutation profile and immunoscore signature in thymic carcinomas: An exploratory study and review of the literature.

Thoracic Cancer

Asselta, Rosanna R; Di Tommaso, Luca L; Perrino, Matteo M; Destro, Annarita A; Giordano, Laura L; Cardamone, Giulia G; Rubino, Luca L; Santoro, Armando A; Duga, Stefano S; Zucali, Paolo Andrea PA

Publication Date: 2021-05

Variant appearance in text: KIT: 1663_1713del; V555_I571del

PubMed Link: 33704917

Variant Present in the following documents:

• TCA-12-1271-s003.xls, sheet 1

View BVdb publication page

Pan-urologic cancer genomic subtypes that transcend tissue of origin.

Nature Communications

Chen, Fengju F; Zhang, Yiqun Y; Bossé, Dominick D; Lalani, Aly-Khan A AA; Hakimi, A Ari AA; Hsieh, James J JJ; Choueiri, Toni K TK; Gibbons, Don L DL; Ittmann, Michael M; Creighton, Chad J CJ

Publication Date: 2017-08-04

Variant appearance in text: KIT: 1663_1713del; V555_I571del

PubMed Link: 28775315

Variant Present in the following documents:

• 41467_2017_289_MOESM7_ESM.xlsx, sheet 1

View BVdb publication page