KIT c.1666_1689del ;(p.Q556_I563del)

Variant ID: 4-55593597-GTACAGTGGAAGGTTGTTGAGGAGA-G

NM_000222.2(KIT):c.1666_1689del;(p.Q556_I563del)

This variant was identified in 4 publications

View GRCh38 version.




Publications:


Pan-cancer circulating tumor DNA detection in over 10,000 Chinese patients.

Nature Communications
Zhang, Yongliang Y; Yao, Yu Y; Xu, Yaping Y; Li, Lifeng L; Gong, Yan Y; Zhang, Kai K; Zhang, Meng M; Guan, Yanfang Y; Chang, Lianpeng L; Xia, Xuefeng X; Li, Lin L; Jia, Shuqin S; Zeng, Qiang Q
Publication Date: 2021-01-04

Variant appearance in text: KIT: 1666_1689delCAGTGGAAGGTTGTTGAGGAGATA
PubMed Link: 33397889
Variant Present in the following documents:
  • 41467_2020_20162_MOESM6_ESM.xlsx, sheet 1
  • 41467_2020_20162_MOESM10_ESM.xlsx, sheet 1
View BVdb publication page



Clinicopathologic characteristics, diagnostic clues, and prognoses of patients with multiple sporadic gastrointestinal stromal tumors: a case series and review of the literature.

Diagnostic Pathology
Shen, Yan-Ying YY; Ma, Xin-Li XL; Yang, Lin-Xi LX; Zhao, Wen-Yi WY; Tu, Lin L; Zhuang, Chun C; Ni, Bo B; Liu, Qiang Q; Wang, Ming M; Cao, Hui H
Publication Date: 2020-05-14

Variant appearance in text: KIT: Q556_I563del
PubMed Link: 32408889
Variant Present in the following documents:
  • Main text
  • 13000_2020_Article_939.pdf
View BVdb publication page



Comprehensive Genomic Profiling of Rare Tumors: Routes to Targeted Therapies.

Frontiers In Oncology
Wang, Shuhang S; Chen, Rongrong R; Tang, Yu Y; Yu, Yue Y; Fang, Yuan Y; Huang, Huiyao H; Wu, Dawei D; Fang, Hong H; Bai, Ying Y; Sun, Chao C; Yu, Anqi A; Fan, Qi Q; Gu, Dejian D; Yi, Xin X; Li, Ning N
Publication Date: 2020

Variant appearance in text: KIT: 1666_1689delCAGTGGAAGGTTGTTGAGGAGATA; Q556_I563del
PubMed Link: 32373528
Variant Present in the following documents:
  • Table_6.xlsx, sheet 1
View BVdb publication page



Molecular Comparison of Imatinib-Naïve and Resistant Gastrointestinal Stromal Tumors: Differentially Expressed microRNAs and mRNAs.

Cancers
Amirnasr, Azadeh A; Gits, Caroline M M CMM; van Kuijk, Patricia F PF; Smid, Marcel M; Vriends, Anne L M ALM; Rutkowski, Piotr P; Sciot, Raf R; Schöffski, Patrick P; Debiec-Rychter, Maria M; Sleijfer, Stefan S; Wiemer, Erik A C EAC
Publication Date: 2019-06-24

Variant appearance in text: KIT: Q556_I563del
PubMed Link: 31238586
Variant Present in the following documents:
  • Main text
  • cancers-11-00882.pdf
View BVdb publication page