Publications:

---

Identification of New Tumor-Related Gene Mutations in Chinese Gastrointestinal Stromal Tumors.

Frontiers In Cell And Developmental Biology

Feng, Yuyang Y; Yao, Surui S; Pu, Zhening Z; Cheng, Han H; Fei, Bojian B; Zou, Jian J; Huang, Zhaohui Z

Publication Date: 2021

Variant appearance in text: KIT: 1675_1695del

PubMed Link: 34805171

Variant Present in the following documents:

• Main text
• fcell-09-764275.pdf

View BVdb publication page

---

Mutation profile and immunoscore signature in thymic carcinomas: An exploratory study and review of the literature.

Thoracic Cancer

Asselta, Rosanna R; Di Tommaso, Luca L; Perrino, Matteo M; Destro, Annarita A; Giordano, Laura L; Cardamone, Giulia G; Rubino, Luca L; Santoro, Armando A; Duga, Stefano S; Zucali, Paolo Andrea PA

Publication Date: 2021-05

Variant appearance in text: KIT: 1675_1695del; V559_G565del

PubMed Link: 33704917

Variant Present in the following documents:

• TCA-12-1271-s003.xls, sheet 1

View BVdb publication page

---

Comprehensive Genomic Profiling of Rare Tumors: Routes to Targeted Therapies.

Frontiers In Oncology

Wang, Shuhang S; Chen, Rongrong R; Tang, Yu Y; Yu, Yue Y; Fang, Yuan Y; Huang, Huiyao H; Wu, Dawei D; Fang, Hong H; Bai, Ying Y; Sun, Chao C; Yu, Anqi A; Fan, Qi Q; Gu, Dejian D; Yi, Xin X; Li, Ning N

Publication Date: 2020

Variant appearance in text: KIT: 1675_1695delGTTGTTGAGGAGATAAATGGA; V559_G565del

PubMed Link: 32373528

Variant Present in the following documents:

• Table_6.xlsx, sheet 1

View BVdb publication page

---

KIT and PDGFRa mutational patterns in Sardinian patients with gastrointestinal stromal tumors.

European Journal Of Cancer Prevention : The Official Journal Of The European Cancer Prevention Organisation (Ecp)

Palomba, Grazia G; Paliogiannis, Panagiotis P; Sini, Maria C MC; Colombino, Maria M; Casula, Milena M; Manca, Antonella A; Pisano, Marina M; Sotgiu, Giovanni G; Doneddu, Valentina V; Palmieri, Giuseppe G; Cossu, Antonio A

Publication Date: 2021-01

Variant appearance in text: KIT: Val559_Gly565del

PubMed Link: 32091431

Variant Present in the following documents:

• ejcp-30-53-s001.pdf

View BVdb publication page

---

Pan-urologic cancer genomic subtypes that transcend tissue of origin.

Nature Communications

Chen, Fengju F; Zhang, Yiqun Y; Bossé, Dominick D; Lalani, Aly-Khan A AA; Hakimi, A Ari AA; Hsieh, James J JJ; Choueiri, Toni K TK; Gibbons, Don L DL; Ittmann, Michael M; Creighton, Chad J CJ

Publication Date: 2017-08-04

Variant appearance in text: KIT: 1675_1695del; V559_G565del

PubMed Link: 28775315

Variant Present in the following documents:

• 41467_2017_289_MOESM7_ESM.xlsx, sheet 1

View BVdb publication page

---

Genome-wide chemical mutagenesis screens allow unbiased saturation of the cancer genome and identification of drug resistance mutations.

Genome Research

Brammeld, Jonathan S JS; Petljak, Mia M; Martincorena, Inigo I; Williams, Steven P SP; Alonso, Luz Garcia LG; Dalmases, Alba A; Bellosillo, Beatriz B; Robles-Espinoza, Carla Daniela CD; Price, Stacey S; Barthorpe, Syd S; Tarpey, Patrick P; Alifrangis, Constantine C; Bignell, Graham G; Vidal, Joana J; Young, Jamie J; Stebbings, Lucy L; Beal, Kathryn K; Stratton, Michael R MR; Saez-Rodriguez, Julio J; Garnett, Mathew M; Montagut, Clara C; Iorio, Francesco F; McDermott, Ultan U

Publication Date: 2017-04

Variant appearance in text: KIT: 1675_1695del; V559_G565del

PubMed Link: 28179366

Variant Present in the following documents:

• supp_gr.213546.116_Supplemental_Table_S7.xlsx, sheet 1

View BVdb publication page

---