Publications:

---

Genomic Landscape of RTK/RAS Pathway and Tumor Immune Infiltration as Prognostic Indicator of Lung Adenocarcinoma.

Frontiers In Oncology

Yin, Xiang-Qian XQ; Yin, Xue-Hui XH; Yu, Ya-Qin YQ; Xu, Lang L; Zhang, Mao M

Publication Date: 2022

Variant appearance in text: KIT: 1708_1728del; Y570_L576del

PubMed Link: 35936718

Variant Present in the following documents:

• Table_4.xlsx, sheet 2

View BVdb publication page

---

Integrated genomic analyses of acral and mucosal melanomas nominate novel driver genes.

Genome Medicine

Wang, Meng M; Banik, Ishani I; Shain, A Hunter AH; Yeh, Iwei I; Bastian, Boris C BC

Publication Date: 2022-06-16

Variant appearance in text: KIT: 1706_1726del

PubMed Link: 35706047

Variant Present in the following documents:

• 13073_2022_1068_MOESM4_ESM.xlsx, sheet 1

View BVdb publication page

---

Molecular Portrait of GISTs Associated With Clinicopathological Features: A Retrospective Study With Molecular Analysis by a Custom 9-Gene Targeted Next-Generation Sequencing Panel.

Frontiers In Genetics

Qian, Haoran H; Yan, Na N; Hu, Xiaotong X; Jiang, Junchang J; Cao, Zhengzheng Z; Shen, Dan D

Publication Date: 2022

Variant appearance in text: KIT: Y570_L576del

PubMed Link: 35547262

Variant Present in the following documents:

• DataSheet1.xlsx, sheet 1

View BVdb publication page

---

Circulating Tumor DNA Mutations in Progressive Gastrointestinal Stromal Tumors Identify Biomarkers of Treatment Resistance and Uncover Potential Therapeutic Strategies.

Frontiers In Oncology

Ko, Tun Kiat TK; Lee, Elizabeth E; Ng, Cedric Chuan-Young CC; Yang, Valerie Shiwen VS; Farid, Mohamad M; Teh, Bin Tean BT; Chan, Jason Yongsheng JY; Somasundaram, Nagavalli N

Publication Date: 2022

Variant appearance in text: KIT: 1708_1728del

PubMed Link: 35273917

Variant Present in the following documents:

• Main text
• fonc-12-840843.pdf

View BVdb publication page

---

Systematic review and meta-analysis of genomic alterations in acral melanoma.

Pigment Cell & Melanoma Research

Broit, Natasa N; Johansson, Peter A PA; Rodgers, Chloe B CB; Walpole, Sebastian T ST; Hayward, Nicholas K NK; Pritchard, Antonia L AL

Publication Date: 2022-05

Variant appearance in text: KIT: 1708_1728del; Tyr570_Leu576del

PubMed Link: 35229492

Variant Present in the following documents:

• PCMR-35-369-s003.xlsx, sheet 6

View BVdb publication page

---

Mutation profile and immunoscore signature in thymic carcinomas: An exploratory study and review of the literature.

Thoracic Cancer

Asselta, Rosanna R; Di Tommaso, Luca L; Perrino, Matteo M; Destro, Annarita A; Giordano, Laura L; Cardamone, Giulia G; Rubino, Luca L; Santoro, Armando A; Duga, Stefano S; Zucali, Paolo Andrea PA

Publication Date: 2021-05

Variant appearance in text: KIT: 1708_1728del; Y570_L576del

PubMed Link: 33704917

Variant Present in the following documents:

• TCA-12-1271-s003.xls, sheet 1

View BVdb publication page

---

Type and Gene Location of KIT Mutations Predict Progression-Free Survival to First-Line Imatinib in Gastrointestinal Stromal Tumors: A Look into the Exon.

Cancers

Incorvaia, Lorena L; Fanale, Daniele D; Vincenzi, Bruno B; De Luca, Ida I; Bartolotta, Tommaso Vincenzo TV; Cannella, Roberto R; Pantuso, Gianni G; Cabibi, Daniela D; Russo, Antonio A; Bazan, Viviana V; Badalamenti, Giuseppe G

Publication Date: 2021-02-27

Variant appearance in text: KIT: Y570_L576del

PubMed Link: 33673554

Variant Present in the following documents:

• Main text
• cancers-13-00993.pdf

View BVdb publication page

---

Assessment of Clinical Benefit of Integrative Genomic Profiling in Advanced Solid Tumors.

Jama Oncology

Cobain, Erin F EF; Wu, Yi-Mi YM; Vats, Pankaj P; Chugh, Rashmi R; Worden, Francis F; Smith, David C DC; Schuetze, Scott M SM; Zalupski, Mark M MM; Sahai, Vaibhav V; Alva, Ajjai A; Schott, Anne F AF; Caram, Megan E V MEV; Hayes, Daniel F DF; Stoffel, Elena M EM; Jacobs, Michelle F MF; Kumar-Sinha, Chandan C; Cao, Xuhong X; Wang, Rui R; Lucas, David D; Ning, Yu Y; Rabban, Erica E; Bell, Janice J; Camelo-Piragua, Sandra S; Udager, Aaron M AM; Cieslik, Marcin M; Lonigro, Robert J RJ; Kunju, Lakshmi P LP; Robinson, Dan R DR; Talpaz, Moshe M; Chinnaiyan, Arul M AM

Publication Date: 2021-04-01

Variant appearance in text: KIT: Y570_L576del

PubMed Link: 33630025

Variant Present in the following documents:

• jamaoncol-e207987-s004.xlsx, sheet 2

View BVdb publication page

---

Integrated molecular drivers coordinate biological and clinical states in melanoma.

Nature Genetics

Conway, Jake R JR; Dietlein, Felix F; Taylor-Weiner, Amaro A; AlDubayan, Saud S; Vokes, Natalie N; Keenan, Tanya T; Reardon, Brendan B; He, Meng Xiao MX; Margolis, Claire A CA; Weirather, Jason L JL; Haq, Rizwan R; Schilling, Bastian B; Stephen Hodi, F F; Schadendorf, Dirk D; Liu, David D; Van Allen, Eliezer M EM

Publication Date: 2020-12

Variant appearance in text: KIT: 1706_1726delTTTACATAGACCCAACACAAC

PubMed Link: 33230298

Variant Present in the following documents:

• NIHMS1637640-supplement-SuppData1.xlsx, sheet 1

View BVdb publication page

---

Broad ligament Extraintestinal Gastrointestinal Stromal Tumor (EGIST): Case report and brief overview of EGIST.

Gynecologic Oncology Reports

Nezhat, Farr R FR; Zavala Retes, Benjamin B; White, Michael P MP; Donovan, Virginia V; Pejovic, Tanja T

Publication Date: 2020-08

Variant appearance in text: KIT: Y570_L576del

PubMed Link: 32885016

Variant Present in the following documents:

• Main text
• main.pdf

View BVdb publication page

---

Genetic Characterization of Molecular Targets in Korean Patients with Gastrointestinal Stromal Tumors.

Journal Of Gastric Cancer

Park, Joonhong J; Yoo, Han Mo HM; Sul, Hae Jung HJ; Shin, Soyoung S; Lee, Seung Woo SW; Kim, Jeong Goo JG

Publication Date: 2020-03

Variant appearance in text: KIT: 1708_1728del

PubMed Link: 32269842

Variant Present in the following documents:

• Main text
• jgc-20-29.pdf

View BVdb publication page

---

Driver gene alterations and activated signaling pathways toward malignant progression of gastrointestinal stromal tumors.

Cancer Science

Ohshima, Keiichi K; Fujiya, Keiichi K; Nagashima, Takeshi T; Ohnami, Sumiko S; Hatakeyama, Keiichi K; Urakami, Kenichi K; Naruoka, Akane A; Watanabe, Yuko Y; Moromizato, Sachi S; Shimoda, Yuji Y; Ohnami, Shumpei S; Serizawa, Masakuni M; Akiyama, Yasuto Y; Kusuhara, Masatoshi M; Mochizuki, Tohru T; Sugino, Takashi T; Shiomi, Akio A; Tsubosa, Yasuhiro Y; Uesaka, Katsuhiko K; Terashima, Masanori M; Yamaguchi, Ken K

Publication Date: 2019-12

Variant appearance in text: KIT: 1708_1728delTACATAGACCCAACACAACTT; Y570_L576del

PubMed Link: 31553483

Variant Present in the following documents:

• CAS-110-3821-s012.xlsx, sheet 1
• CAS-110-3821-s008.xlsx, sheet 1
• CAS-110-3821-s012.xlsx, sheet 2
• CAS-110-3821-s009.xlsx, sheet 1

View BVdb publication page

---

Multiple gastrointestinal stromal tumors: analysis of clinicopathologic characteristics and prognosis of 20 patients.

Cancer Management And Research

Li, Kai K; Tjhoi, Weh W; Shou, Chunhui C; Yang, Weili W; Zhang, Qing Q; Liu, Xiaosun X; Yu, Jiren J

Publication Date: 2019

Variant appearance in text: KIT: Y570_L576del

PubMed Link: 31413638

Variant Present in the following documents:

• Main text
• cmar-11-7031.pdf

View BVdb publication page

---

The assessment of minimal residual disease versus that of somatic mutations for predicting the outcome of acute myeloid leukemia patients.

Cancer Cell International

Salehzadeh, Serena S; Guerrini, Francesca F; Pizzano, Umberto U; Grassi, Susanna S; Ciabatti, Elena E; Iovino, Lorenzo L; Buda, Gabriele G; Caracciolo, Francesco F; Benedetti, Edoardo E; Orciuolo, Enrico E; Pelosini, Matteo M; Consani, Giovanni G; Carulli, Giovanni G; Metelli, Maria Rita MR; Martini, Francesca F; Mazziotta, Francesco F; Mazzantini, Elisa E; Rossi, Pietro P; Tavarozzi, Rita R; Ricci, Federica F; Petrini, Mario M; Galimberti, Sara S

Publication Date: 2019

Variant appearance in text: KIT: 1708_1728del; Y570_L576del

PubMed Link: 30992690

Variant Present in the following documents:

• Main text
• 12935_2019_Article_807.pdf

View BVdb publication page

---

Establishment and characterization of patient-derived xenograft models of gastrointestinal stromal tumor resistant to standard tyrosine kinase inhibitors.

Oncotarget

Na, Young-Soon YS; Ryu, Min-Hee MH; Yoo, Changhoon C; Lee, Ju-Kyung JK; Park, Jung Min JM; Lee, Chae-Won CW; Lee, Sun Young SY; Shin, Young-Kyoung YK; Ku, Ja-Lok JL; Ahn, Sung-Min SM; Kang, Yoon-Koo YK

Publication Date: 2017-09-29

Variant appearance in text: KIT: Y570_L576del

PubMed Link: 29100343

Variant Present in the following documents:

• Main text
• oncotarget-08-76712.pdf

View BVdb publication page

---

Pan-urologic cancer genomic subtypes that transcend tissue of origin.

Nature Communications

Chen, Fengju F; Zhang, Yiqun Y; Bossé, Dominick D; Lalani, Aly-Khan A AA; Hakimi, A Ari AA; Hsieh, James J JJ; Choueiri, Toni K TK; Gibbons, Don L DL; Ittmann, Michael M; Creighton, Chad J CJ

Publication Date: 2017-08-04

Variant appearance in text: KIT: 1708_1728del; Y570_L576del

PubMed Link: 28775315

Variant Present in the following documents:

• 41467_2017_289_MOESM7_ESM.xlsx, sheet 1

View BVdb publication page

---

NF1-mutated melanoma tumors harbor distinct clinical and biological characteristics.

Molecular Oncology

Cirenajwis, Helena H; Lauss, Martin M; Ekedahl, Henrik H; Törngren, Therese T; Kvist, Anders A; Saal, Lao H LH; Olsson, Håkan H; Staaf, Johan J; Carneiro, Ana A; Ingvar, Christian C; Harbst, Katja K; Hayward, Nicholas K NK; Jönsson, Göran G

Publication Date: 2017-04

Variant appearance in text: KIT: 1706_1726delTTTACATAGACCCAACACAAC

PubMed Link: 28267273

Variant Present in the following documents:

• MOL2-11-438-s003.xls, sheet 1

View BVdb publication page

---

Genome-wide chemical mutagenesis screens allow unbiased saturation of the cancer genome and identification of drug resistance mutations.

Genome Research

Brammeld, Jonathan S JS; Petljak, Mia M; Martincorena, Inigo I; Williams, Steven P SP; Alonso, Luz Garcia LG; Dalmases, Alba A; Bellosillo, Beatriz B; Robles-Espinoza, Carla Daniela CD; Price, Stacey S; Barthorpe, Syd S; Tarpey, Patrick P; Alifrangis, Constantine C; Bignell, Graham G; Vidal, Joana J; Young, Jamie J; Stebbings, Lucy L; Beal, Kathryn K; Stratton, Michael R MR; Saez-Rodriguez, Julio J; Garnett, Mathew M; Montagut, Clara C; Iorio, Francesco F; McDermott, Ultan U

Publication Date: 2017-04

Variant appearance in text: KIT: 1708_1728del; Y570_L576del

PubMed Link: 28179366

Variant Present in the following documents:

• supp_gr.213546.116_Supplemental_Table_S7.xlsx, sheet 1

View BVdb publication page

---

Massively parallel sequencing fails to detect minor resistant subclones in tissue samples prior to tyrosine kinase inhibitor therapy.

Bmc Cancer

Heydt, Carina C; Kumm, Niklas N; Fassunke, Jana J; Künstlinger, Helen H; Ihle, Michaela Angelika MA; Scheel, Andreas A; Schildhaus, Hans-Ulrich HU; Haller, Florian F; Büttner, Reinhard R; Odenthal, Margarete M; Wardelmann, Eva E; Merkelbach-Bruse, Sabine S

Publication Date: 2015-04-15

Variant appearance in text: KIT: Y570_L576del

PubMed Link: 25886408

Variant Present in the following documents:

• Main text
• 12885_2015_Article_1311.pdf

View BVdb publication page

---

Melanoma genome sequencing reveals frequent PREX2 mutations.

Nature

Berger, Michael F MF; Hodis, Eran E; Heffernan, Timothy P TP; Deribe, Yonathan Lissanu YL; Lawrence, Michael S MS; Protopopov, Alexei A; Ivanova, Elena E; Watson, Ian R IR; Nickerson, Elizabeth E; Ghosh, Papia P; Zhang, Hailei H; Zeid, Rhamy R; Ren, Xiaojia X; Cibulskis, Kristian K; Sivachenko, Andrey Y AY; Wagle, Nikhil N; Sucker, Antje A; Sougnez, Carrie C; Onofrio, Robert R; Ambrogio, Lauren L; Auclair, Daniel D; Fennell, Timothy T; Carter, Scott L SL; Drier, Yotam Y; Stojanov, Petar P; Singer, Meredith A MA; Voet, Douglas D; Jing, Rui R; Saksena, Gordon G; Barretina, Jordi J; Ramos, Alex H AH; Pugh, Trevor J TJ; Stransky, Nicolas N; Parkin, Melissa M; Winckler, Wendy W; Mahan, Scott S; Ardlie, Kristin K; Baldwin, Jennifer J; Wargo, Jennifer J; Schadendorf, Dirk D; Meyerson, Matthew M; Gabriel, Stacey B SB; Golub, Todd R TR; Wagner, Stephan N SN; Lander, Eric S ES; Getz, Gad G; Chin, Lynda L; Garraway, Levi A LA

Publication Date: 2012-05-09

Variant appearance in text: KIT: 1706_1726delTTTACATAGACCCAACACAAC

PubMed Link: 22622578

Variant Present in the following documents:

• NIHMS362881-supplement-3.xlsx, sheet 7

View BVdb publication page

---