SLC34A1 c.272_292del ;(p.V91_A97del)

Variant ID: 5-176813232-GGTCCCCAAGCTGCGCCAGGCT-G

NM_003052.4(SLC34A1):c.272_292del;(p.V91_A97del)

This variant was identified in 15 publications

View GRCh38 version.




Publications:


Evaluation of in silico pathogenicity prediction tools for the classification of small in-frame indels.

Bmc Medical Genomics
Cannon, S S; Williams, M M; Gunning, A C AC; Wright, C F CF
Publication Date: 2023-02-28

Variant appearance in text: SLC34A1: 272_292del; Val91_Ala97del
PubMed Link: 36855133
Variant Present in the following documents:
  • 12920_2023_1454_MOESM2_ESM.xlsx, sheet 1
View BVdb publication page



Relationship between clinical phenotype and in vitro analysis of 13 NPT2c/SCL34A3 mutants.

Scientific Reports
Brazier, François F; Courbebaisse, Marie M; David, Amandine A; Bergerat, David D; Leroy, Christine C; Lindner, Marta M; Maruani, Gérard G; Saint Jacques, Camille C; Letavernier, Emmanuel E; Hureaux, Marguerite M; Vargas-Poussou, Rosa R; Prié, Dominique D
Publication Date: 2023-01-03

Variant appearance in text: SLC34A1: 272_292del; Val91_Ala97del
PubMed Link: 36596813
Variant Present in the following documents:
  • Main text
  • 41598_2022_25995_MOESM1_ESM.pdf
  • 41598_2022_Article_25995.pdf
View BVdb publication page



Genetic associations of protein-coding variants in human disease.

Nature
Sun, Benjamin B BB; Kurki, Mitja I MI; Foley, Christopher N CN; Mechakra, Asma A; Chen, Chia-Yen CY; Marshall, Eric E; Wilk, Jemma B JB; , ; Chahine, Mohamed M; Chevalier, Philippe P; Christé, Georges G; , ; Palotie, Aarno A; Daly, Mark J MJ; Runz, Heiko H
Publication Date: 2022-03

Variant appearance in text: SLC34A1: Val91_Ala97del
PubMed Link: 35197637
Variant Present in the following documents:
  • Main text
  • 41586_2022_Article_4394.pdf
View BVdb publication page



Answer ALS, a large-scale resource for sporadic and familial ALS combining clinical and multi-omics data from induced pluripotent cell lines.

Nature Neuroscience
Baxi, Emily G EG; Thompson, Terri T; Li, Jonathan J; Kaye, Julia A JA; Lim, Ryan G RG; Wu, Jie J; Ramamoorthy, Divya D; Lima, Leandro L; Vaibhav, Vineet V; Matlock, Andrea A; Frank, Aaron A; Coyne, Alyssa N AN; Landin, Barry B; Ornelas, Loren L; Mosmiller, Elizabeth E; Thrower, Sara S; Farr, S Michelle SM; Panther, Lindsey L; Gomez, Emilda E; Galvez, Erick E; Perez, Daniel D; Meepe, Imara I; Lei, Susan S; Mandefro, Berhan B; Trost, Hannah H; Pinedo, Louis L; Banuelos, Maria G MG; Liu, Chunyan C; Moran, Ruby R; Garcia, Veronica V; Workman, Michael M; Ho, Richie R; Wyman, Stacia S; Roggenbuck, Jennifer J; Harms, Matthew B MB; Stocksdale, Jennifer J; Miramontes, Ricardo R; Wang, Keona K; Venkatraman, Vidya V; Holewenski, Ronald R; Sundararaman, Niveda N; Pandey, Rakhi R; Manalo, Danica-Mae DM; Donde, Aneesh A; Huynh, Nhan N; Adam, Miriam M; Wassie, Brook T BT; Vertudes, Edward E; Amirani, Naufa N; Raja, Krishna K; Thomas, Reuben R; Hayes, Lindsey L; Lenail, Alex A; Cerezo, Aianna A; Luppino, Sarah S; Farrar, Alanna A; Pothier, Lindsay L; Prina, Carolyn C; Morgan, Todd T; Jamil, Arish A; Heintzman, Sarah S; Jockel-Balsarotti, Jennifer J; Karanja, Elizabeth E; Markway, Jesse J; McCallum, Molly M; Joslin, Ben B; Alibazoglu, Deniz D; Kolb, Stephen S; Ajroud-Driss, Senda S; Baloh, Robert R; Heitzman, Daragh D; Miller, Tim T; Glass, Jonathan D JD; Patel-Murray, Natasha Leanna NL; Yu, Hong H; Sinani, Ervin E; Vigneswaran, Prasha P; Sherman, Alexander V AV; Ahmad, Omar O; Roy, Promit P; Beavers, Jay C JC; Zeiler, Steven S; Krakauer, John W JW; Agurto, Carla C; Cecchi, Guillermo G; Bellard, Mary M; Raghav, Yogindra Y; Sachs, Karen K; Ehrenberger, Tobias T; Bruce, Elizabeth E; Cudkowicz, Merit E ME; Maragakis, Nicholas N; Norel, Raquel R; Van Eyk, Jennifer E JE; Finkbeiner, Steven S; Berry, James J; Sareen, Dhruv D; Thompson, Leslie M LM; Fraenkel, Ernest E; Svendsen, Clive N CN; Rothstein, Jeffrey D JD
Publication Date: 2022-02

Variant appearance in text: SLC34A1: 271_291del; V91_A97del; rs876661296
PubMed Link: 35115730
Variant Present in the following documents:
  • 41593_2021_1006_MOESM4_ESM.xlsx, sheet 7
View BVdb publication page



Comprehensive Genetic Analysis Reveals Complexity of Monogenic Urinary Stone Disease.

Kidney International Reports
Cogal, Andrea G AG; Arroyo, Jennifer J; Shah, Ronak Jagdeep RJ; Reese, Kalina J KJ; Walton, Brenna N BN; Reynolds, Laura M LM; Kennedy, Gabrielle N GN; Seide, Barbara M BM; Senum, Sarah R SR; Baum, Michelle M; Erickson, Stephen B SB; Jagadeesh, Sujatha S; Soliman, Neveen A NA; Goldfarb, David S DS; Beara-Lasic, Lada L; Edvardsson, Vidar O VO; Palsson, Runolfur R; Milliner, Dawn S DS; Sas, David J DJ; Lieske, John C JC; Harris, Peter C PC; ,
Publication Date: 2021-11

Variant appearance in text: SLC34A1: 272_292del; Val91_Ala97del
PubMed Link: 34805638
Variant Present in the following documents:
  • Main text
  • main.pdf
View BVdb publication page



Overlapping Phenotypes Associated With CYP24A1, SLC34A1, and SLC34A3 Mutations: A Cohort Study of Patients With Hypersensitivity to Vitamin D.

Frontiers In Endocrinology
Molin, Arnaud A; Lemoine, Sandrine S; Kaufmann, Martin M; Breton, Pierre P; Nowoczyn, Marie M; Ballandonne, Céline C; Coudray, Nadia N; Mittre, Hervé H; Richard, Nicolas N; Ryckwaert, Amélie A; Lavillaureix, Alinoe A; Jones, Glenville G; Bacchetta, Justine J; Kottler, Marie-Laure ML
Publication Date: 2021

Variant appearance in text: SLC34A1: 272_292del; Val91_Ala97del
PubMed Link: 34721296
Variant Present in the following documents:
  • Main text
  • fendo-12-736240.pdf
View BVdb publication page



Five patients with disorders of calcium metabolism presented with GCM2 gene variants.

Scientific Reports
García-Castaño, Alejandro A; Madariaga, Leire L; Gómez-Conde, Sara S; Cordo, Carmen Lourdes Rey CLR; López-Iglesias, María M; Garcia-Fernández, Yolanda Y; Martín, Alicia A; González, Pedro P; Goicolea, Ignacio I; de Nanclares, Gustavo Pérez GP; De la Hoz, Ana Belén AB; Aguayo, Aníbal A; de LaPiscina, Idoia Martínez IM; Martínez, Rosa R; Saso, Laura L; Urrutia, Inés I; Velasco, Olaia O; Castaño, Luis L; Gaztambide, Sonia S
Publication Date: 2021-02-03

Variant appearance in text: SLC34A1: 272_292delTCCCCAAGCTGCGCCAGGCTG; Val91_Ala97del
PubMed Link: 33536578
Variant Present in the following documents:
  • Main text
  • 41598_2021_Article_82661.pdf
View BVdb publication page



Long-term outcome of the survivors of infantile hypercalcaemia with CYP24A1 and SLC34A1 mutations.

Nephrology, Dialysis, Transplantation : Official Publication Of The European Dialysis And Transplant Association - European Renal Association
Janiec, Agnieszka A; Halat-Wolska, Paulina P; Obrycki, Łukasz Ł; Ciara, Elżbieta E; Wójcik, Marek M; Płudowski, Paweł P; Wierzbicka, Aldona A; Kowalska, Ewa E; Książyk, Janusz B JB; Kułaga, Zbigniew Z; Pronicka, Ewa E; Litwin, Mieczysław M
Publication Date: 2021-07-23

Variant appearance in text: SLC34A1: V91_A97del
PubMed Link: 33099630
Variant Present in the following documents:
  • Main text
  • gfaa178.pdf
View BVdb publication page



Reinterpretation of common pathogenic variants in ClinVar revealed a high proportion of downgrades.

Scientific Reports
Xiang, Jiale J; Yang, Jiyun J; Chen, Lisha L; Chen, Qiang Q; Yang, Haiyan H; Sun, Chengcheng C; Zhou, Qing Q; Peng, Zhiyu Z
Publication Date: 2020-01-15

Variant appearance in text: SLC34A1: 272_292delTCCCCAAGCTGCGCCAGGCTG; Val91_Ala97del
PubMed Link: 31942019
Variant Present in the following documents:
  • 41598_2019_57335_MOESM1_ESM.xlsx, sheet 1
View BVdb publication page



Investigation of new candidate genes in retinoblastoma using the TruSight One "clinical exome" gene panel.

Molecular Genetics & Genomic Medicine
Akdeniz, Demet D; Tuncer, Seref Bugra SB; Kebudi, Rejin R; Celik, Betul B; Kuru, Gozde G; Kilic, Seda S; Sukruoglu Erdogan, Ozge O; Avsar, Mukaddes M; Buyukkapu Bay, Sema S; Tuncer, Samuray S; Yazici, Hulya H
Publication Date: 2019-08

Variant appearance in text: SLC34A1: 272_292del; Val91_Ala97del
PubMed Link: 31207142
Variant Present in the following documents:
  • Main text
  • MGG3-7-e785.pdf
View BVdb publication page



Clinical, biochemical, and pathophysiological analysis of SLC34A1 mutations.

Physiological Reports
Fearn, Amy A; Allison, Benjamin B; Rice, Sarah J SJ; Edwards, Noel N; Halbritter, Jan J; Bourgeois, Soline S; Pastor-Arroyo, Eva M EM; Hildebrandt, Friedhelm F; Tasic, Velibor V; Wagner, Carsten A CA; Hernando, Nati N; Sayer, John A JA; Werner, Andreas A
Publication Date: 2018-06

Variant appearance in text: SLC34A1: 271_291del
PubMed Link: 29924459
Variant Present in the following documents:
  • Main text
  • PHY2-6-e13715.pdf
View BVdb publication page



Benchmarking of Whole Exome Sequencing and Ad Hoc Designed Panels for Genetic Testing of Hereditary Cancer.

Scientific Reports
Feliubadaló, Lídia L; Tonda, Raúl R; Gausachs, Mireia M; Trotta, Jean-Rémi JR; Castellanos, Elisabeth E; López-Doriga, Adriana A; Teulé, Àlex À; Tornero, Eva E; Del Valle, Jesús J; Gel, Bernat B; Gut, Marta M; Pineda, Marta M; González, Sara S; Menéndez, Mireia M; Navarro, Matilde M; Capellá, Gabriel G; Gut, Ivo I; Serra, Eduard E; Brunet, Joan J; Beltran, Sergi S; Lázaro, Conxi C
Publication Date: 2017-01-04

Variant appearance in text: SLC34A1: 272_292delTCCCCAAGCTGCGCCAGGCTG; Val91_Ala97del
PubMed Link: 28050010
Variant Present in the following documents:
  • srep37984-s2.xls, sheet 1
View BVdb publication page



Molecular analysis of urothelial cancer cell lines for modeling tumor biology and drug response.

Oncogene
Nickerson, M L ML; Witte, N N; Im, K M KM; Turan, S S; Owens, C C; Misner, K K; Tsang, S X SX; Cai, Z Z; Wu, S S; Dean, M M; Costello, J C JC; Theodorescu, D D
Publication Date: 2017-01-05

Variant appearance in text: SLC34A1: 272_292del
PubMed Link: 27270441
Variant Present in the following documents:
  • onc2016172x3.xls, sheet 3
View BVdb publication page



Fourteen monogenic genes account for 15% of nephrolithiasis/nephrocalcinosis.

Journal Of The American Society Of Nephrology : Jasn
Halbritter, Jan J; Baum, Michelle M; Hynes, Ann Marie AM; Rice, Sarah J SJ; Thwaites, David T DT; Gucev, Zoran S ZS; Fisher, Brittany B; Spaneas, Leslie L; Porath, Jonathan D JD; Braun, Daniela A DA; Wassner, Ari J AJ; Nelson, Caleb P CP; Tasic, Velibor V; Sayer, John A JA; Hildebrandt, Friedhelm F
Publication Date: 2015-03

Variant appearance in text: SLC34A1: 271_291del; Val91_Ala97del
PubMed Link: 25296721
Variant Present in the following documents:
  • Main text
View BVdb publication page