EGFR c.2235_2255delinsAAT ;(p.E746_S752delinsI)

Variant ID: 7-55242465-GGAATTAAGAGAAGCAACATC-AAT

NM_005228.3(EGFR):c.2235_2255delinsAAT;(p.E746_S752delinsI)

This variant was identified in 2 publications

View GRCh38 version.



Variant-Specific Resource Links:
gnomAD v2.1.1
Mutalizer Name Checker
Google
UCSC Genome Browser
ClinVar
dbSNP

Publications:

An integrated somatic and germline approach to aid interpretation of germline variants of uncertain significance in cancer susceptibility genes.

Frontiers In Oncology
Schwartz, Alison A; Manning, Danielle K DK; Koeller, Diane R DR; Chittenden, Anu A; Isidro, Raymond A RA; Hayes, Connor P CP; Abraamyan, Feruza F; Manam, Monica Devi MD; Dwan, Meaghan M; Barletta, Justine A JA; Sholl, Lynette M LM; Yurgelun, Matthew B MB; Rana, Huma Q HQ; Garber, Judy E JE; Ghazani, Arezou A AA
Publication Date: 2022

Variant appearance in text: EGFR: 2235_2255delinsAAT
PubMed Link: 36091175
Variant Present in the following documents:
  • Main text
  • fonc-12-942741.pdf
View BVdb publication page


EGFR-Mutated Squamous Cell Lung Cancer and Its Association With Outcomes.

Frontiers In Oncology
Jin, Rui R; Peng, Ling L; Shou, Jiawei J; Wang, Jin J; Jin, Yin Y; Liang, Fei F; Zhao, Jing J; Wu, Mengmeng M; Li, Qin Q; Zhang, Bin B; Wu, Xiaoying X; Lan, Fen F; Xia, Lixia L; Yan, Junrong J; Shao, Yang Y; Stebbing, Justin J; Shen, Huahao H; Li, Wen W; Xia, Yang Y
Publication Date: 2021

Variant appearance in text: EGFR: 2235_2255delGGAATTAAGAGAAGCAACATCinsAAT
PubMed Link: 34195081
Variant Present in the following documents:
  • Table_2.xlsx, sheet 1
View BVdb publication page