Publications:

Pan-cancer circulating tumor DNA detection in over 10,000 Chinese patients.

Nature Communications

Zhang, Yongliang Y; Yao, Yu Y; Xu, Yaping Y; Li, Lifeng L; Gong, Yan Y; Zhang, Kai K; Zhang, Meng M; Guan, Yanfang Y; Chang, Lianpeng L; Xia, Xuefeng X; Li, Lin L; Jia, Shuqin S; Zeng, Qiang Q

Publication Date: 2021-01-04

Variant appearance in text: EGFR: 2236_2255delGAATTAAGAGAAGCAACATCinsAT

PubMed Link: 33397889

Variant Present in the following documents:

• 41467_2020_20162_MOESM10_ESM.xlsx, sheet 1

View BVdb publication page

Rapid EGFR mutation testing in lung cancer tissue samples using a fully automated system and single-use cartridge.

Practical Laboratory Medicine

Al-Turkmani, M Rabie MR; Suriawinata, Michael A MA; Deharvengt, Sophie J SJ; Green, Donald C DC; Black, Candice C CC; Shirai, Keisuke K; Dragnev, Konstantin H KH; Tsongalis, Gregory J GJ

Publication Date: 2020-05

Variant appearance in text: EGFR: 2236_2255delinsAT

PubMed Link: 32181314

Variant Present in the following documents:

• Main text
• main.pdf

View BVdb publication page

Analysis of resistance mechanisms to abivertinib, a third-generation EGFR tyrosine kinase inhibitor, in patients with EGFR T790M-positive non-small cell lung cancer from a phase I trial.

Ebiomedicine

Zhang, Yi-Chen YC; Chen, Zhi-Hong ZH; Zhang, Xu-Chao XC; Xu, Chong-Rui CR; Yan, Hong-Hong HH; Xie, Zhi Z; Chuai, Shao-Kun SK; Ye, Jun-Yi JY; Han-Zhang, Han H; Zhang, Zhou Z; Bai, Xiao-Yan XY; Su, Jian J; Gan, Bin B; Yang, Jin-Ji JJ; Li, Wen-Feng WF; Tang, Wei W; Luo, Feng Roger FR; Xu, Xiao X; Wu, Yi-Long YL; Zhou, Qing Q

Publication Date: 2019-05

Variant appearance in text: EGFR: 2236_2255delinsAT

PubMed Link: 31027916

Variant Present in the following documents:

• mmc3.xlsx, sheet 1

View BVdb publication page

Optimization of EGFR mutation detection by the fully-automated qPCR-based Idylla system on tumor tissue from patients with non-small cell lung cancer.

Oncotarget

Ilie, Marius M; Butori, Catherine C; Lassalle, Sandra S; Heeke, Simon S; Piton, Nicolas N; Sabourin, Jean-Christophe JC; Tanga, Virginie V; Washetine, Kevin K; Long-Mira, Elodie E; Maitre, Priscilla P; Yazbeck, Nathalie N; Bordone, Olivier O; Lespinet, Virginie V; Leroy, Sylvie S; Cohen, Charlotte C; Mouroux, Jérôme J; Marquette, Charles Hugo CH; Hofman, Véronique V; Hofman, Paul P

Publication Date: 2017-11-28

Variant appearance in text: EGFR: 2236_2255delinsAT

PubMed Link: 29262544

Variant Present in the following documents:

• oncotarget-08-103055-s003.xlsx, sheet 1

View BVdb publication page