Publications:

Genomic Alterations Identification and Resistance Mechanisms Exploration of NSCLC With Central Nervous System Metastases Using Liquid Biopsy of Cerebrospinal Fluid: A Real-World Study.

Frontiers In Oncology

Shen, Fangfang F; Liang, Naixin N; Fan, Zaiwen Z; Zhao, Min M; Kang, Jing J; Wang, Xifang X; Hu, Qun Q; Mu, Yongping Y; Wang, Kai K; Yuan, Mingming M; Chen, Rongrong R; Guo, Wei W; Dong, Guilan G; Zhao, Jun J; Bai, Jun J

Publication Date: 2022

Variant appearance in text: EGFR: 2238_2258delATTAAGAGAAGCAACATCTCCinsGCAACA

PubMed Link: 35814426

Variant Present in the following documents:

• DataSheet_1.xlsx, sheet 2

View BVdb publication page

Intertumoural Heterogeneity and Branch Evolution of Synchronous Multiple Primary Lung Adenocarcinomas by Next-Generation Sequencing Analysis.

Frontiers In Oncology

Zhang, Qinleng Q; Jia, Hui H; Wang, Zhendan Z; Hao, Shaoyu S; Huang, Haiyan H; Yang, Airong A; Han, Lu L; Song, Pingping P

Publication Date: 2021

Variant appearance in text: EGFR: 2238_2258delinsGCAACA

PubMed Link: 34804960

Variant Present in the following documents:

• Table_1.xls, sheet 1

View BVdb publication page