EGFR c.2239_2258delinsCA ;(p.L747_P753delinsQ)

Variant ID: 7-55242469-TTAAGAGAAGCAACATCTCC-CA

NM_005228.3(EGFR):c.2239_2258delinsCA;(p.L747_P753delinsQ)

This variant was identified in 6 publications

View GRCh38 version.



Variant-Specific Resource Links:
gnomAD v2.1.1
Mutalizer Name Checker
Google
UCSC Genome Browser
ClinVar
dbSNP

Publications:

Candidate mechanisms of acquired resistance to first-line osimertinib in EGFR-mutated advanced non-small cell lung cancer.

Nature Communications
Chmielecki, Juliann J; Gray, Jhanelle E JE; Cheng, Ying Y; Ohe, Yuichiro Y; Imamura, Fumio F; Cho, Byoung Chul BC; Lin, Meng-Chih MC; Majem, Margarita M; Shah, Riyaz R; Rukazenkov, Yuri Y; Todd, Alexander A; Markovets, Aleksandra A; Barrett, J Carl JC; Hartmaier, Ryan J RJ; Ramalingam, Suresh S SS
Publication Date: 2023-02-27

Variant appearance in text: EGFR: 2239_2258delTTAAGAGAAGCAACATCTCCinsCA
PubMed Link: 36849494
Variant Present in the following documents:
  • 41467_2023_35961_MOESM3_ESM.xlsx, sheet 2
View BVdb publication page


Evaluation of the Idylla ctEGFR mutation assay to detect EGFR mutations in plasma from patients with non-small cell lung cancers.

Scientific Reports
Gilson, Pauline P; Saurel, Chloé C; Salleron, Julia J; Husson, Marie M; Demange, Jessica J; Merlin, Jean-Louis JL; Harlé, Alexandre A
Publication Date: 2021-05-18

Variant appearance in text: EGFR: 2239_2258delinsCA
PubMed Link: 34006948
Variant Present in the following documents:
  • 41598_2021_90091_MOESM2_ESM.pdf
View BVdb publication page


Pan-cancer circulating tumor DNA detection in over 10,000 Chinese patients.

Nature Communications
Zhang, Yongliang Y; Yao, Yu Y; Xu, Yaping Y; Li, Lifeng L; Gong, Yan Y; Zhang, Kai K; Zhang, Meng M; Guan, Yanfang Y; Chang, Lianpeng L; Xia, Xuefeng X; Li, Lin L; Jia, Shuqin S; Zeng, Qiang Q
Publication Date: 2021-01-04

Variant appearance in text: EGFR: 2239_2258delTTAAGAGAAGCAACATCTCCinsCA
PubMed Link: 33397889
Variant Present in the following documents:
  • 41467_2020_20162_MOESM10_ESM.xlsx, sheet 1
View BVdb publication page


Rapid EGFR mutation testing in lung cancer tissue samples using a fully automated system and single-use cartridge.

Practical Laboratory Medicine
Al-Turkmani, M Rabie MR; Suriawinata, Michael A MA; Deharvengt, Sophie J SJ; Green, Donald C DC; Black, Candice C CC; Shirai, Keisuke K; Dragnev, Konstantin H KH; Tsongalis, Gregory J GJ
Publication Date: 2020-05

Variant appearance in text: EGFR: 2239_2258delinsCA
PubMed Link: 32181314
Variant Present in the following documents:
  • Main text
  • main.pdf
View BVdb publication page


Optimization of EGFR mutation detection by the fully-automated qPCR-based Idylla system on tumor tissue from patients with non-small cell lung cancer.

Oncotarget
Ilie, Marius M; Butori, Catherine C; Lassalle, Sandra S; Heeke, Simon S; Piton, Nicolas N; Sabourin, Jean-Christophe JC; Tanga, Virginie V; Washetine, Kevin K; Long-Mira, Elodie E; Maitre, Priscilla P; Yazbeck, Nathalie N; Bordone, Olivier O; Lespinet, Virginie V; Leroy, Sylvie S; Cohen, Charlotte C; Mouroux, Jérôme J; Marquette, Charles Hugo CH; Hofman, Véronique V; Hofman, Paul P
Publication Date: 2017-11-28

Variant appearance in text: EGFR: 2239_2258delinsCA
PubMed Link: 29262544
Variant Present in the following documents:
  • oncotarget-08-103055-s003.xlsx, sheet 1
View BVdb publication page


High resolution melting analysis for rapid and sensitive EGFR and KRAS mutation detection in formalin fixed paraffin embedded biopsies.

Bmc Cancer
Do, Hongdo H; Krypuy, Michael M; Mitchell, Paul L PL; Fox, Stephen B SB; Dobrovic, Alexander A
Publication Date: 2008-05-21

Variant appearance in text: EGFR: 2239_2258del20insCA
PubMed Link: 18495026
Variant Present in the following documents:
  • Main text
  • 1471-2407-8-142.pdf
View BVdb publication page