Publications:

Genomic Alterations Identification and Resistance Mechanisms Exploration of NSCLC With Central Nervous System Metastases Using Liquid Biopsy of Cerebrospinal Fluid: A Real-World Study.

Frontiers In Oncology

Shen, Fangfang F; Liang, Naixin N; Fan, Zaiwen Z; Zhao, Min M; Kang, Jing J; Wang, Xifang X; Hu, Qun Q; Mu, Yongping Y; Wang, Kai K; Yuan, Mingming M; Chen, Rongrong R; Guo, Wei W; Dong, Guilan G; Zhao, Jun J; Bai, Jun J

Publication Date: 2022

Variant appearance in text: EGFR: 2251_2277delACATCTCCGAAAGCCAACAAGGAAATCinsTCT

PubMed Link: 35814426

Variant Present in the following documents:

• DataSheet_1.xlsx, sheet 2

View BVdb publication page

Investigation of PALB2 Mutation and Correlation With Immunotherapy Biomarker in Chinese Non-Small Cell Lung Cancer Patients.

Frontiers In Oncology

Zhang, Jiexia J; Tang, Shuangfeng S; Zhang, Chunning C; Li, Mingyao M; Zheng, Yating Y; Hu, Xue X; Huang, Mengli M; Cheng, Xiangyang X

Publication Date: 2021

Variant appearance in text: EGFR: 2251_2277delinsTCT

PubMed Link: 35087742

Variant Present in the following documents:

• Table_2.xlsx, sheet 1

View BVdb publication page