Publications:

---

Network expansion of genetic associations defines a pleiotropy map of human cell biology.

Nature Genetics

Barrio-Hernandez, Inigo I; Schwartzentruber, Jeremy J; Shrivastava, Anjali A; Del-Toro, Noemi N; Gonzalez, Asier A; Zhang, Qian Q; Mountjoy, Edward E; Suveges, Daniel D; Ochoa, David D; Ghoussaini, Maya M; Bradley, Glyn G; Hermjakob, Henning H; Orchard, Sandra S; Dunham, Ian I; Anderson, Carl A CA; Porras, Pablo P; Beltrao, Pedro P

Publication Date: 2023-02-23

Variant appearance in text: EGFR: 2253_2276del; Ser752_Ile759del

PubMed Link: 36823319

Variant Present in the following documents:

• 41588_2023_1327_MOESM4_ESM.xlsx, sheet 6

View BVdb publication page

---

Case report: olaparib use in metastatic lung adenocarcinoma with BRCA2 pathogenic variant.

Cold Spring Harbor Molecular Case Studies

Soon Jian Hao, Jonathan J; Hoai, Chan Sock CS; Weng, Daniel Tan Shao DTS; Ngeow, Joanne J; Chiang, Jianbang J

Publication Date: 2022-12

Variant appearance in text: EGFR: 2253_2276del; S752_I759del

PubMed Link: 36577523

Variant Present in the following documents:

• supp_mcs.a006223_Supplemental_Material.pdf

View BVdb publication page

---

NSCLC patients with rare EGFR Ex19del/G724S mutation showed good response to afatinib combined with chemotherapy treatment: A two-case report.

Frontiers In Oncology

Wang, Huilin H; Yu, Qitao Q; Shi, Lina L; Hou, Qinhan Q; Dan, Liang L; Liang, Chuqiao C; Hong, Xiaoyu X; Zhao, Yun Y; Ning, Ruiling R

Publication Date: 2022

Variant appearance in text: EGFR: 2253_2276del; S752_I759del

PubMed Link: 36505860

Variant Present in the following documents:

• Main text
• fonc-12-1054593.pdf

View BVdb publication page

---

An EGFR L858R mutation identified in 1862 Chinese NSCLC patients can be a promising neoantigen vaccine therapeutic strategy.

Frontiers In Immunology

Lin, Jing J; Liu, Jun J; Hao, Shi-Guang SG; Lan, Bin B; Zheng, Xiao-Bin XB; Xiong, Jia-Ni JN; Zhang, Ying-Qian YQ; Gao, Xuan X; Chen, Chuan-Ben CB; Chen, Ling L; Huang, Yu-Fang YF; Luo, Hong H; Yi, Yu-Ting YT; Yi, Xin X; Lu, Jian-Ping JP; Zheng, Xiong-Wei XW; Chen, Gang G; Wang, Xue-Feng XF; Chen, Yu Y

Publication Date: 2022

Variant appearance in text: EGFR: 2253_2276delATCTCCGAAAGCCAACAAGGAAAT; S752_I759del

PubMed Link: 36505399

Variant Present in the following documents:

• Table_2.xlsx, sheet 3
• Table_2.xlsx, sheet 2

View BVdb publication page

---

Landscape of EGFR mutations in lung adenocarcinoma: a single institute experience with comparison of PANAMutyper testing and targeted next-generation sequencing.

Journal Of Pathology And Translational Medicine

Lee, Jeonghyo J; Han, Yeon Bi YB; Kwon, Hyun Jung HJ; Lee, Song Kook SK; Kim, Hyojin H; Chung, Jin-Haeng JH

Publication Date: 2022-09

Variant appearance in text: EGFR: 2253_2276del; S752_I759del

PubMed Link: 36128861

Variant Present in the following documents:

• jptm-2022-06-11-suppl1.pdf

View BVdb publication page

---

Successful salvage therapy using high-dose furmonertinib (AST2818) for non-small-cell lung cancer after Osimertinib resistance: a case report.

Anti-Cancer Drugs

Cheng, Daoan D; Tang, Shuxian S; Li, Dong D; Zhao, Weiqing W; Wei, Wei W; Fang, Cheng C; Ji, Mei M

Publication Date: 2022-09-01

Variant appearance in text: N/A

PubMed Link: 35946524

Variant Present in the following documents:

View BVdb publication page

---

Genomic Landscape of RTK/RAS Pathway and Tumor Immune Infiltration as Prognostic Indicator of Lung Adenocarcinoma.

Frontiers In Oncology

Yin, Xiang-Qian XQ; Yin, Xue-Hui XH; Yu, Ya-Qin YQ; Xu, Lang L; Zhang, Mao M

Publication Date: 2022

Variant appearance in text: EGFR: 2253_2276del; S752_I759del

PubMed Link: 35936718

Variant Present in the following documents:

• Table_4.xlsx, sheet 2

View BVdb publication page

---

Clinical and genomic features of Chinese lung cancer patients with germline mutations.

Nature Communications

Peng, Wenying W; Li, Bin B; Li, Jin J; Chang, Lianpeng L; Bai, Jing J; Yi, Yuting Y; Chen, Rongrong R; Zhang, Yanyan Y; Chen, Chen C; Pu, Xingxiang X; Jiang, Meilin M; Li, Jia J; Zhong, Rui R; Xu, Fang F; Chen, Bolin B; Xu, Li L; Wang, Ning N; Huan, Jiaojiao J; Dai, Pingping P; Guan, Yanfang Y; Yang, Ling L; Xia, Xuefeng X; Yi, Xin X; Wang, Jiayin J; Yu, Fenglei F; Wu, Lin L

Publication Date: 2022-03-10

Variant appearance in text: EGFR: 2253_2276delATCTCCGAAAGCCAACAAGGAAAT; S752_I759del

PubMed Link: 35273153

Variant Present in the following documents:

• 41467_2022_28840_MOESM7_ESM.xlsx, sheet 1

View BVdb publication page

---

Custom multi‑tumor next‑generation sequencing panel for routine molecular diagnosis of solid tumors: Validation and results from three‑year clinical use.

International Journal Of Molecular Medicine

Chevrier, Sandy S; Brasselet, Astrid A; Carnet, Marion M; Chevriaux, Angélique A; Gibeaud, Anne A; Jourdain, Marine M; Mananet, Hugo H; Truntzer, Caroline C; Beltjens, Françoise F; Charon-Barra, Céline C; Arnould, Laurent L; Albuisson, Juliette J; Comte, Anthony A; Derangère, Valentin V; Goussot, Vincent V; Boidot, Romain R

Publication Date: 2022-05

Variant appearance in text: EGFR: 2253_2276delATCTCCGAAAGCCAACAAGGAAAT; Ser752_Ile759del

PubMed Link: 35244186

Variant Present in the following documents:

• Supplementary_Data3.xlsx, sheet 1

View BVdb publication page

---

Establishment and application of a method of next generation sequencing of 285 genes in lung cancer based on Ion-Proton platform.

Translational Cancer Research

Chen, Yu Y; Zhang, Xu-Chao XC; Yan, Wen-Qing WQ; Guo, Wei-Bang WB; Xie, Zhi Z; Lu, Dan-Xia DX; Lv, Zhi-Yi ZY; Chen, Zhi-Hong ZH; Su, Jian J

Publication Date: 2020-07

Variant appearance in text: EGFR: 2253_2276delATCTCCGAAAGCCAACAAGGAAAT; Ser752_Ile759del

PubMed Link: 35117791

Variant Present in the following documents:

• Main text

View BVdb publication page

---

Precision cancer genome testing needs proficiency testing involving all stakeholders.

Scientific Reports

Maekawa, Masato M; Taniguchi, Terumi T; Nishio, Kazuto K; Sakai, Kazuko K; Matsushita, Kazuyuki K; Nakatani, Kaname K; Ishige, Takayuki T; Ikejiri, Makoto M; Nishihara, Hiroshi H; Sunami, Kuniko K; Yatabe, Yasushi Y; Hatanaka, Kanako C KC; Hatanaka, Yutaka Y; Yamamoto, Yoshihiro Y; Fukuyama, Keita K; Oda, Shinya S; Saito, Kayoko K; Yokomura, Mamoru M; Kubo, Yuji Y; Sato, Hiroko H; Tanaka, Yoshinori Y; Fuchioka, Misa M; Yamasaki, Tadashi T; Matsuda, Koichiro K; Kurachi, Kiyotaka K; Funai, Kazuhiro K; Baba, Satoshi S; Iwaizumi, Moriya M

Publication Date: 2022-01-27

Variant appearance in text: EGFR: 2253_2276del; Ser752_Ile759del

PubMed Link: 35087199

Variant Present in the following documents:

• Main text
• 41598_2022_Article_5589.pdf

View BVdb publication page

---

Precision cancer genome testing needs proficiency testing involving all stakeholders.

Scientific Reports

Maekawa, Masato M; Taniguchi, Terumi T; Nishio, Kazuto K; Sakai, Kazuko K; Matsushita, Kazuyuki K; Nakatani, Kaname K; Ishige, Takayuki T; Ikejiri, Makoto M; Nishihara, Hiroshi H; Sunami, Kuniko K; Yatabe, Yasushi Y; Hatanaka, Kanako C KC; Hatanaka, Yutaka Y; Yamamoto, Yoshihiro Y; Fukuyama, Keita K; Oda, Shinya S; Saito, Kayoko K; Yokomura, Mamoru M; Kubo, Yuji Y; Sato, Hiroko H; Tanaka, Yoshinori Y; Fuchioka, Misa M; Yamasaki, Tadashi T; Matsuda, Koichiro K; Kurachi, Kiyotaka K; Funai, Kazuhiro K; Baba, Satoshi S; Iwaizumi, Moriya M

Publication Date: 2022-01-27

Variant appearance in text: EGFR: 2253_2276del; Ser752_Ile759del

PubMed Link: 35087199

Variant Present in the following documents:

• Main text
• 41598_2022_Article_5589.pdf

View BVdb publication page

---

Evaluation of the Idylla ctEGFR mutation assay to detect EGFR mutations in plasma from patients with non-small cell lung cancers.

Scientific Reports

Gilson, Pauline P; Saurel, Chloé C; Salleron, Julia J; Husson, Marie M; Demange, Jessica J; Merlin, Jean-Louis JL; Harlé, Alexandre A

Publication Date: 2021-05-18

Variant appearance in text: EGFR: 2253_2276del

PubMed Link: 34006948

Variant Present in the following documents:

• 41598_2021_90091_MOESM2_ESM.pdf

View BVdb publication page

---

Mutation profile and immunoscore signature in thymic carcinomas: An exploratory study and review of the literature.

Thoracic Cancer

Asselta, Rosanna R; Di Tommaso, Luca L; Perrino, Matteo M; Destro, Annarita A; Giordano, Laura L; Cardamone, Giulia G; Rubino, Luca L; Santoro, Armando A; Duga, Stefano S; Zucali, Paolo Andrea PA

Publication Date: 2021-05

Variant appearance in text: EGFR: 2253_2276del; S752_I759del

PubMed Link: 33704917

Variant Present in the following documents:

• TCA-12-1271-s003.xls, sheet 1

View BVdb publication page

---

Pan-cancer circulating tumor DNA detection in over 10,000 Chinese patients.

Nature Communications

Zhang, Yongliang Y; Yao, Yu Y; Xu, Yaping Y; Li, Lifeng L; Gong, Yan Y; Zhang, Kai K; Zhang, Meng M; Guan, Yanfang Y; Chang, Lianpeng L; Xia, Xuefeng X; Li, Lin L; Jia, Shuqin S; Zeng, Qiang Q

Publication Date: 2021-01-04

Variant appearance in text: EGFR: 2253_2276delATCTCCGAAAGCCAACAAGGAAAT; S752_I759del

PubMed Link: 33397889

Variant Present in the following documents:

• 41467_2020_20162_MOESM6_ESM.xlsx, sheet 1
• 41467_2020_20162_MOESM10_ESM.xlsx, sheet 1

View BVdb publication page

---

Comprehensive Genomic Profiling of Rare Tumors: Routes to Targeted Therapies.

Frontiers In Oncology

Wang, Shuhang S; Chen, Rongrong R; Tang, Yu Y; Yu, Yue Y; Fang, Yuan Y; Huang, Huiyao H; Wu, Dawei D; Fang, Hong H; Bai, Ying Y; Sun, Chao C; Yu, Anqi A; Fan, Qi Q; Gu, Dejian D; Yi, Xin X; Li, Ning N

Publication Date: 2020

Variant appearance in text: EGFR: 2253_2276delATCTCCGAAAGCCAACAAGGAAAT; S752_I759del

PubMed Link: 32373528

Variant Present in the following documents:

• Table_6.xlsx, sheet 1

View BVdb publication page

---

Molecular Diagnostic of Solid Tumor Using a Next Generation Sequencing Custom-Designed Multi-Gene Panel.

Diagnostics (Basel, Switzerland)

de Biase, Dario D; Acquaviva, Giorgia G; Visani, Michela M; Sanza, Viviana V; Argento, Chiara M CM; De Leo, Antonio A; Maloberti, Thais T; Pession, Annalisa A; Tallini, Giovanni G

Publication Date: 2020-04-23

Variant appearance in text: EGFR: 2253_2276del; S752_I759del

PubMed Link: 32340363

Variant Present in the following documents:

• diagnostics-10-00250-s001.pdf

View BVdb publication page

---

Rapid EGFR mutation testing in lung cancer tissue samples using a fully automated system and single-use cartridge.

Practical Laboratory Medicine

Al-Turkmani, M Rabie MR; Suriawinata, Michael A MA; Deharvengt, Sophie J SJ; Green, Donald C DC; Black, Candice C CC; Shirai, Keisuke K; Dragnev, Konstantin H KH; Tsongalis, Gregory J GJ

Publication Date: 2020-05

Variant appearance in text: EGFR: 2253_2276del

PubMed Link: 32181314

Variant Present in the following documents:

• Main text
• main.pdf

View BVdb publication page

---

Differential significance of molecular subtypes which were classified into EGFR exon 19 deletion on the first line afatinib monotherapy.

Bmc Cancer

Tokudome, Nahomi N; Koh, Yasuhiro Y; Akamatsu, Hiroaki H; Fujimoto, Daichi D; Okamoto, Isamu I; Nakagawa, Kazuhiko K; Hida, Toyoaki T; Imamura, Fumio F; Morita, Satoshi S; Yamamoto, Nobuyuki N

Publication Date: 2020-02-06

Variant appearance in text: N/A

PubMed Link: 32028909

Variant Present in the following documents:

View BVdb publication page

---

Targeted next-generation sequencing in cytology specimens for molecular profiling of lung adenocarcinoma.

International Journal Of Clinical And Experimental Pathology

Zhang, Yuan Y; Li, Jinnan J; Hua, Ping P; Liu, Nian N; Li, Qiyuan Q; Zhu, Xianglan X; Jiang, Lili L; Zheng, Ke K; Su, Xueying X

Publication Date: 2018

Variant appearance in text: EGFR: 2253_2276del

PubMed Link: 31949745

Variant Present in the following documents:

• Main text

View BVdb publication page

---

Variation in nomenclature of somatic variants for selection of oncological therapies: Can we reach a consensus soon?

Human Mutation

Keppens, Cleo C; Tack, Véronique V; Dufraing, Kelly K; Rouleau, Etienne E; Ligtenberg, Marjolijn J L MJL; Schuuring, Ed E; Dequeker, Elisabeth M C EMC

Publication Date: 2020-01

Variant appearance in text: EGFR: 2253_2276del

PubMed Link: 31553104

Variant Present in the following documents:

• Main text
• HUMU-41-7-s001.pdf
• HUMU-41-7.pdf

View BVdb publication page

---

De novo MET amplification promotes intrinsic resistance to first-generation EGFR tyrosine kinase inhibitors.

Cancer Biology & Therapy

Li, Jing-Wen JW; Cao, Shu-Hui SH; Xu, Jian-Lin JL; Zhong, Hua H

Publication Date: 2019

Variant appearance in text: EGFR: 2253_2276del; Ser752_Ile759del

PubMed Link: 31131689

Variant Present in the following documents:

• Main text
• kcbt-20-09-1617568.pdf

View BVdb publication page

---

Heterogeneous mutation pattern in tumor tissue and circulating tumor DNA warrants parallel NGS panel testing.

Molecular Cancer

Guo, Qiaomei Q; Wang, Junlei J; Xiao, Jianfeng J; Wang, Lin L; Hu, Xiaomeng X; Yu, Wenjun W; Song, Gang G; Lou, Jiatao J; Chen, JianFeng J

Publication Date: 2018-08-28

Variant appearance in text: EGFR: 2253_2276delATCTCCGAAAGCCAACAAGGAAAT; Ser752_Ile759del

PubMed Link: 30153823

Variant Present in the following documents:

• 12943_2018_875_MOESM5_ESM.xlsx, sheet 1

View BVdb publication page

---

Fibroblast growth factor receptor 3 (FGFR3) aberrations in muscle-invasive urothelial carcinoma.

Bmc Urology

Kim, Young Saing YS; Kim, Kyung K; Kwon, Ghee-Young GY; Lee, Su Jin SJ; Park, Se Hoon SH

Publication Date: 2018-07-31

Variant appearance in text: EGFR: 2253_2276del; S752_I759del

PubMed Link: 30064409

Variant Present in the following documents:

• 12894_2018_380_MOESM1_ESM.xlsx, sheet 1

View BVdb publication page

---

Feasibility study of cancer genome alterations identified by next generation sequencing: ABC study.

Japanese Journal Of Clinical Oncology

Naito, Yoichi Y; Takahashi, Hideaki H; Shitara, Kohei K; Okamoto, Wataru W; Bando, Hideaki H; Kuwata, Takeshi T; Kuboki, Yasutoshi Y; Matsumoto, Shingo S; Miki, Izumi I; Yamanaka, Takeharu T; Watanabe, Atsushi A; Kojima, Motohiro M

Publication Date: 2018-06-01

Variant appearance in text: EGFR: 2253_2276del; S752_I759del

PubMed Link: 29659903

Variant Present in the following documents:

• hyy052supplementaltable1ionver1.xls, sheet 1

View BVdb publication page

---

Molecular characteristics and clinical outcomes of EGFR exon 19 indel subtypes to EGFR TKIs in NSCLC patients.

Oncotarget

Su, Jian J; Zhong, Wenzhao W; Zhang, Xuchao X; Huang, Ying Y; Yan, Honghong H; Yang, Jinji J; Dong, Zhongyi Z; Xie, Zhi Z; Zhou, Qing Q; Huang, Xiaosui X; Lu, Danxia D; Yan, Wenqing W; Wu, Yi-Long YL

Publication Date: 2017-12-19

Variant appearance in text: EGFR: 2253_2276del

PubMed Link: 29340050

Variant Present in the following documents:

• Main text
• oncotarget-08-111246.pdf

View BVdb publication page

---

Droplet digital PCR-based EGFR mutation detection with an internal quality control index to determine the quality of DNA.

Scientific Reports

Kim, Sung-Su SS; Choi, Hyun-Jeung HJ; Kim, Jin Ju JJ; Kim, M Sun MS; Lee, In-Seon IS; Byun, Bohyun B; Jia, Lina L; Oh, Myung Ryurl MR; Moon, Youngho Y; Park, Sarah S; Choi, Joon-Seok JS; Chae, Seoung Wan SW; Nam, Byung-Ho BH; Kim, Jin-Soo JS; Kim, Jihun J; Min, Byung Soh BS; Lee, Jae Seok JS; Won, Jae-Kyung JK; Cho, Soo Youn SY; Choi, Yoon-La YL; Shin, Young Kee YK

Publication Date: 2018-01-11

Variant appearance in text: EGFR: 2253_2276del; S752_I759del

PubMed Link: 29323170

Variant Present in the following documents:

• 41598_2017_18642_MOESM1_ESM.pdf

View BVdb publication page

---

Optimization of EGFR mutation detection by the fully-automated qPCR-based Idylla system on tumor tissue from patients with non-small cell lung cancer.

Oncotarget

Ilie, Marius M; Butori, Catherine C; Lassalle, Sandra S; Heeke, Simon S; Piton, Nicolas N; Sabourin, Jean-Christophe JC; Tanga, Virginie V; Washetine, Kevin K; Long-Mira, Elodie E; Maitre, Priscilla P; Yazbeck, Nathalie N; Bordone, Olivier O; Lespinet, Virginie V; Leroy, Sylvie S; Cohen, Charlotte C; Mouroux, Jérôme J; Marquette, Charles Hugo CH; Hofman, Véronique V; Hofman, Paul P

Publication Date: 2017-11-28

Variant appearance in text: EGFR: 2253_2276del

PubMed Link: 29262544

Variant Present in the following documents:

• oncotarget-08-103055-s003.xlsx, sheet 1

View BVdb publication page

---

Molecular Characterization of Urothelial Carcinoma of the Bladder and Upper Urinary Tract.

Translational Oncology

Lee, Ji Yun JY; Kim, Kyung K; Sung, Hyun Hwan HH; Jeon, Hwang Gyun HG; Jeong, Byong Chang BC; Seo, Seong Il SI; Jeon, Seong Soo SS; Lee, Hyun Moo HM; Choi, Han-Yong HY; Kwon, Ghee-Young GY; Kim, Kyoung-Mee KM; Lee, Jeeyun J; Lim, Ho Yeong HY; Park, Se Hoon SH

Publication Date: 2018-02

Variant appearance in text: EGFR: 2253_2276del; S752_I759del

PubMed Link: 29161613

Variant Present in the following documents:

• mmc1.xlsx, sheet 1

View BVdb publication page

---

Evaluation of pre-analytical conditions and comparison of the performance of several digital PCR assays for the detection of major EGFR mutations in circulating DNA from non-small cell lung cancers: the CIRCAN_0 study.

Oncotarget

Garcia, Jessica J; Dusserre, Eric E; Cheynet, Valérie V; Bringuier, Pierre Paul PP; Brengle-Pesce, Karen K; Wozny, Anne-Sophie AS; Rodriguez-Lafrasse, Claire C; Freyer, Gilles G; Brevet, Marie M; Payen, Léa L; Couraud, Sébastien S

Publication Date: 2017-10-20

Variant appearance in text: N/A

PubMed Link: 29152135

Variant Present in the following documents:

View BVdb publication page

---

Cancer gene profiling in non-small cell lung cancers reveals activating mutations in JAK2 and JAK3 with therapeutic implications.

Genome Medicine

Li, Shuyu D SD; Ma, Meng M; Li, Hui H; Waluszko, Aneta A; Sidorenko, Tatyana T; Schadt, Eric E EE; Zhang, David Y DY; Chen, Rong R; Ye, Fei F

Publication Date: 2017-10-30

Variant appearance in text: EGFR: 2253_2276del; S752_I759del

PubMed Link: 29082853

Variant Present in the following documents:

• 13073_2017_478_MOESM1_ESM.xlsx, sheet 2

View BVdb publication page

---

Prevalence of EGFR Mutations in Lung Cancer in Uruguayan Population.

Journal Of Cancer Epidemiology

Berois, Nora N; Touya, Diego D; Ubillos, Luis L; Bertoni, Bernardo B; Osinaga, Eduardo E; Varangot, Mario M

Publication Date: 2017

Variant appearance in text: EGFR: 2253_2276del; S752_I759del

PubMed Link: 28744312

Variant Present in the following documents:

• Main text
• JCE2017-6170290.pdf

View BVdb publication page

---

Genome-wide chemical mutagenesis screens allow unbiased saturation of the cancer genome and identification of drug resistance mutations.

Genome Research

Brammeld, Jonathan S JS; Petljak, Mia M; Martincorena, Inigo I; Williams, Steven P SP; Alonso, Luz Garcia LG; Dalmases, Alba A; Bellosillo, Beatriz B; Robles-Espinoza, Carla Daniela CD; Price, Stacey S; Barthorpe, Syd S; Tarpey, Patrick P; Alifrangis, Constantine C; Bignell, Graham G; Vidal, Joana J; Young, Jamie J; Stebbings, Lucy L; Beal, Kathryn K; Stratton, Michael R MR; Saez-Rodriguez, Julio J; Garnett, Mathew M; Montagut, Clara C; Iorio, Francesco F; McDermott, Ultan U

Publication Date: 2017-04

Variant appearance in text: EGFR: 2253_2276del; S752_I759del

PubMed Link: 28179366

Variant Present in the following documents:

• supp_gr.213546.116_Supplemental_Table_S7.xlsx, sheet 1

View BVdb publication page

---

VarDict: a novel and versatile variant caller for next-generation sequencing in cancer research.

Nucleic Acids Research

Lai, Zhongwu Z; Markovets, Aleksandra A; Ahdesmaki, Miika M; Chapman, Brad B; Hofmann, Oliver O; McEwen, Robert R; Johnson, Justin J; Dougherty, Brian B; Barrett, J Carl JC; Dry, Jonathan R JR

Publication Date: 2016-06-20

Variant appearance in text: EGFR: 2253_2276delATCTCCGAAAGCCAACAAGGAAAT

PubMed Link: 27060149

Variant Present in the following documents:

• supp_gkw227_nar-03544-met-k-2015-File003.xls, sheet 2

View BVdb publication page

---

Prospective Evaluation of First-Line Erlotinib in Advanced Non-Small Cell Lung Cancer (NSCLC) Carrying an Activating EGFR Mutation: A Multicenter Academic Phase II Study in Caucasian Patients (FIELT).

Plos One

De Grève, Jacques J; Van Meerbeeck, Jan J; Vansteenkiste, Johan F JF; Decoster, Lore L; Meert, Anne-Pascale AP; Vuylsteke, Peter P; Focan, Christian C; Canon, Jean-Luc JL; Humblet, Yves Y; Berchem, Guy G; Colinet, Benoit B; Galdermans, Danny D; Bosquée, Lionel L; Vermeij, Joanna J; Dewaele, Alex A; Geers, Caroline C; Schallier, Denis D; Teugels, Erik E

Publication Date: 2016

Variant appearance in text: EGFR: 2253_2276del; Ser752_Ile759del

PubMed Link: 27032107

Variant Present in the following documents:

• Main text
• pone.0147599.pdf

View BVdb publication page

---

Mutational profiling of brain metastasis from breast cancer: matched pair analysis of targeted sequencing between brain metastasis and primary breast cancer.

Oncotarget

Lee, Ji Yun JY; Park, Kyunghee K; Lim, Sung Hee SH; Kim, Hae Su HS; Yoo, Kwai Han KH; Jung, Ki Sun KS; Song, Haa-Na HN; Hong, Mineui M; Do, In-Gu IG; Ahn, TaeJin T; Lee, Se Kyung SK; Bae, Soo Youn SY; Kim, Seok Won SW; Lee, Jeong Eon JE; Nam, Seok Jin SJ; Kim, Duk-Hwan DH; Jung, Hae Hyun HH; Kim, Ji-Yeon JY; Ahn, Jin Seok JS; Im, Young-Hyuck YH; Park, Yeon Hee YH

Publication Date: 2015-12-22

Variant appearance in text: EGFR: 2253_2276del; S752_I759del

PubMed Link: 26527317

Variant Present in the following documents:

• oncotarget-06-43731-s002.xlsx, sheet 1

View BVdb publication page

---

Patient-derived cell models as preclinical tools for genome-directed targeted therapy.

Oncotarget

Lee, Ji Yun JY; Kim, Sun Young SY; Park, Charny C; Kim, Nayoung K D NK; Jang, Jiryeon J; Park, Kyunghee K; Yi, Jun Ho JH; Hong, Mineui M; Ahn, Taejin T; Rath, Oliver O; Schueler, Julia J; Kim, Seung Tae ST; Do, In-Gu IG; Lee, Sujin S; Park, Se Hoon SH; Ji, Yong Ick YI; Kim, Dukwhan D; Park, Joon Oh JO; Park, Young Suk YS; Kang, Won Ki WK; Kim, Kyoung-Mee KM; Park, Woong-Yang WY; Lim, Ho Yeong HY; Lee, Jeeyun J

Publication Date: 2015-09-22

Variant appearance in text: EGFR: 2253_2276del; S752_I759del

PubMed Link: 26296973

Variant Present in the following documents:

• oncotarget-06-25619-s003.xls, sheet 1

View BVdb publication page

---

The mutation rates of EGFR in non-small cell lung cancer and KRAS in colorectal cancer of Chinese patients as detected by pyrosequencing using a novel dispensation order.

Journal Of Experimental & Clinical Cancer Research : Cr

Xie, Guohua G; Xie, Fang F; Wu, Ping P; Yuan, Xiangliang X; Ma, Yanhui Y; Xu, Yunchuan Y; Li, Li L; Xu, Ling L; Yang, Ming M; Shen, Lisong L

Publication Date: 2015-06-18

Variant appearance in text: EGFR: 2253_2276del

PubMed Link: 26081767

Variant Present in the following documents:

• Main text
• 13046_2015_Article_179.pdf

View BVdb publication page

---

Molecular characterization of patients with pathologic complete response or early failure after neoadjuvant chemotherapy for locally advanced breast cancer using next generation sequencing and nCounter assay.

Oncotarget

Park, Kyunghee K; Choi, Moon Ki MK; Jung, Hae Hyun HH; Do, In-Gu IG; Lee, Kwang Hee KH; Ahn, TaeJin T; Kil, Won Ho WH; Kim, Seok Won SW; Lee, Jeong Eon JE; Nam, Seok Jin SJ; Kim, Duk-Hwan DH; Ahn, Jin Seok JS; Im, Young-Hyuck YH; Park, Yeon Hee YH

Publication Date: 2015-09-15

Variant appearance in text: EGFR: 2253_2276del; S752_I759del

PubMed Link: 26009992

Variant Present in the following documents:

• oncotarget-06-24499-s002.xlsx, sheet 1

View BVdb publication page

---

High-throughput sequencing and copy number variation detection using formalin fixed embedded tissue in metastatic gastric cancer.

Plos One

Kim, Seokhwi S; Lee, Jeeyun J; Hong, Min Eui ME; Do, In-Gu IG; Kang, So Young SY; Ha, Sang Yun SY; Kim, Seung Tae ST; Park, Se Hoon SH; Kang, Won Ki WK; Choi, Min-Gew MG; Lee, Jun Ho JH; Sohn, Tae Sung TS; Bae, Jae Moon JM; Kim, Sung S; Kim, Duk-Hwan DH; Kim, Kyoung-Mee KM

Publication Date: 2014

Variant appearance in text: EGFR: 2253_2276del; S752_I759del

PubMed Link: 25372287

Variant Present in the following documents:

• pone.0111693.s003.xls, sheet 1

View BVdb publication page

---

Identification of candidate genes for lung cancer somatic mutation test kits.

Genetics And Molecular Biology

Chen, Yong Y; Shi, Jian-Xin JX; Pan, Xu-Feng XF; Feng, Jian J; Zhao, Heng H

Publication Date: 2013-09

Variant appearance in text: EGFR: 2253_2276del

PubMed Link: 24130455

Variant Present in the following documents:

• Main text
• 2013-011.pdf

View BVdb publication page

---