Publications:

---

Plasma ctDNA increases tissue NGS-based detection of therapeutically targetable mutations in lung cancers.

Bmc Cancer

Xie, Jianjiang J; Yao, Weishen W; Chen, Lingxiu L; Zhu, Wenjun W; Liu, Qiang Q; Geng, Geng G; Fang, Jing J; Zhao, Yang Y; Xiao, Li L; Huang, Zhenhua Z; Zhao, Jing J

Publication Date: 2023-03-31

Variant appearance in text: EGFR: Ser752_Ile759del

PubMed Link: 37004022

Variant Present in the following documents:

• Main text
• 12885_2023_Article_10674.pdf

View BVdb publication page

---

Network expansion of genetic associations defines a pleiotropy map of human cell biology.

Nature Genetics

Barrio-Hernandez, Inigo I; Schwartzentruber, Jeremy J; Shrivastava, Anjali A; Del-Toro, Noemi N; Gonzalez, Asier A; Zhang, Qian Q; Mountjoy, Edward E; Suveges, Daniel D; Ochoa, David D; Ghoussaini, Maya M; Bradley, Glyn G; Hermjakob, Henning H; Orchard, Sandra S; Dunham, Ian I; Anderson, Carl A CA; Porras, Pablo P; Beltrao, Pedro P

Publication Date: 2023-02-23

Variant appearance in text: EGFR: 2254_2277del; Ser752_Ile759del

PubMed Link: 36823319

Variant Present in the following documents:

• 41588_2023_1327_MOESM4_ESM.xlsx, sheet 6

View BVdb publication page

---

Highly sensitive liquid biopsy Duplex sequencing complements tissue biopsy to enhance detection of clinically relevant genetic variants.

Frontiers In Oncology

Hallermayr, Ariane A; Neuhann, Teresa M TM; Steinke-Lange, Verena V; Scharf, Florentine F; Laner, Andreas A; Ewald, Roland R; Liesfeld, Ben B; Holinski-Feder, Elke E; Pickl, Julia M A JMA

Publication Date: 2022

Variant appearance in text: EGFR: 2254_2277del; S752_I759del

PubMed Link: 36636551

Variant Present in the following documents:

• Table_1.xlsx, sheet 1
• Table_1.xlsx, sheet 10
• Table_1.xlsx, sheet 7

View BVdb publication page

---

An EGFR L858R mutation identified in 1862 Chinese NSCLC patients can be a promising neoantigen vaccine therapeutic strategy.

Frontiers In Immunology

Lin, Jing J; Liu, Jun J; Hao, Shi-Guang SG; Lan, Bin B; Zheng, Xiao-Bin XB; Xiong, Jia-Ni JN; Zhang, Ying-Qian YQ; Gao, Xuan X; Chen, Chuan-Ben CB; Chen, Ling L; Huang, Yu-Fang YF; Luo, Hong H; Yi, Yu-Ting YT; Yi, Xin X; Lu, Jian-Ping JP; Zheng, Xiong-Wei XW; Chen, Gang G; Wang, Xue-Feng XF; Chen, Yu Y

Publication Date: 2022

Variant appearance in text: EGFR: 2254_2277delTCTCCGAAAGCCAACAAGGAAATC; S752_I759del

PubMed Link: 36505399

Variant Present in the following documents:

• Table_2.xlsx, sheet 2

View BVdb publication page

---

Comprehensive characterization of genomic and radiologic features reveals distinct driver patterns of RTK/RAS pathway in ground-glass opacity pulmonary nodules.

International Journal Of Cancer

Yu, Fenglei F; Peng, Muyun M; Bai, Jing J; Zhu, Xiuli X; Zhang, Bingyu B; Tang, Jingqun J; Liu, Wenliang W; Chen, Chen C; Wang, Xiang X; Chen, Mingjiu M; Tan, Sichuang S; Sun, Yi Y; Liang, Qingchun Q; Li, Jina J; Hu, Yan Y; Liao, Aihui A; Hu, Huali H; He, Yu Y; Xiao, Xiao X; Wang, Bin B; Xing, Guanlan G; Xu, Yaping Y; Chen, Rongrong R; Xia, Xuefeng X; Chen, Xiaofeng X

Publication Date: 2022-12-01

Variant appearance in text: EGFR: S752_I759del

PubMed Link: 36029220

Variant Present in the following documents:

• IJC-151-2020.pdf

View BVdb publication page

---

Genomic Landscape of RTK/RAS Pathway and Tumor Immune Infiltration as Prognostic Indicator of Lung Adenocarcinoma.

Frontiers In Oncology

Yin, Xiang-Qian XQ; Yin, Xue-Hui XH; Yu, Ya-Qin YQ; Xu, Lang L; Zhang, Mao M

Publication Date: 2022

Variant appearance in text: EGFR: 2254_2277del; S752_I759del

PubMed Link: 35936718

Variant Present in the following documents:

• Table_4.xlsx, sheet 2

View BVdb publication page

---

Allele-specific activation, enzyme kinetics, and inhibitor sensitivities of EGFR exon 19 deletion mutations in lung cancer.

Proceedings Of The National Academy Of Sciences Of The United States Of America

Brown, Benjamin P BP; Zhang, Yun-Kai YK; Kim, Soyeon S; Finneran, Patrick P; Yan, Yingjun Y; Du, Zhenfang Z; Kim, Jiyoon J; Hartzler, Abigail Leigh AL; LeNoue-Newton, Michele L ML; Smith, Adam W AW; Meiler, Jens J; Lovly, Christine M CM

Publication Date: 2022-07-26

Variant appearance in text: EGFR: S752_I759del

PubMed Link: 35867821

Variant Present in the following documents:

• pnas.2206588119.sapp.pdf

View BVdb publication page

---

Clinical and genomic features of Chinese lung cancer patients with germline mutations.

Nature Communications

Peng, Wenying W; Li, Bin B; Li, Jin J; Chang, Lianpeng L; Bai, Jing J; Yi, Yuting Y; Chen, Rongrong R; Zhang, Yanyan Y; Chen, Chen C; Pu, Xingxiang X; Jiang, Meilin M; Li, Jia J; Zhong, Rui R; Xu, Fang F; Chen, Bolin B; Xu, Li L; Wang, Ning N; Huan, Jiaojiao J; Dai, Pingping P; Guan, Yanfang Y; Yang, Ling L; Xia, Xuefeng X; Yi, Xin X; Wang, Jiayin J; Yu, Fenglei F; Wu, Lin L

Publication Date: 2022-03-10

Variant appearance in text: EGFR: 2254_2277delTCTCCGAAAGCCAACAAGGAAATC; S752_I759del

PubMed Link: 35273153

Variant Present in the following documents:

• 41467_2022_28840_MOESM7_ESM.xlsx, sheet 1

View BVdb publication page

---

Precision cancer genome testing needs proficiency testing involving all stakeholders.

Scientific Reports

Maekawa, Masato M; Taniguchi, Terumi T; Nishio, Kazuto K; Sakai, Kazuko K; Matsushita, Kazuyuki K; Nakatani, Kaname K; Ishige, Takayuki T; Ikejiri, Makoto M; Nishihara, Hiroshi H; Sunami, Kuniko K; Yatabe, Yasushi Y; Hatanaka, Kanako C KC; Hatanaka, Yutaka Y; Yamamoto, Yoshihiro Y; Fukuyama, Keita K; Oda, Shinya S; Saito, Kayoko K; Yokomura, Mamoru M; Kubo, Yuji Y; Sato, Hiroko H; Tanaka, Yoshinori Y; Fuchioka, Misa M; Yamasaki, Tadashi T; Matsuda, Koichiro K; Kurachi, Kiyotaka K; Funai, Kazuhiro K; Baba, Satoshi S; Iwaizumi, Moriya M

Publication Date: 2022-01-27

Variant appearance in text: EGFR: 2254_2277del; Ser752_Ile759del

PubMed Link: 35087199

Variant Present in the following documents:

• 41598_2022_Article_5589.pdf

View BVdb publication page

---

Precision cancer genome testing needs proficiency testing involving all stakeholders.

Scientific Reports

Maekawa, Masato M; Taniguchi, Terumi T; Nishio, Kazuto K; Sakai, Kazuko K; Matsushita, Kazuyuki K; Nakatani, Kaname K; Ishige, Takayuki T; Ikejiri, Makoto M; Nishihara, Hiroshi H; Sunami, Kuniko K; Yatabe, Yasushi Y; Hatanaka, Kanako C KC; Hatanaka, Yutaka Y; Yamamoto, Yoshihiro Y; Fukuyama, Keita K; Oda, Shinya S; Saito, Kayoko K; Yokomura, Mamoru M; Kubo, Yuji Y; Sato, Hiroko H; Tanaka, Yoshinori Y; Fuchioka, Misa M; Yamasaki, Tadashi T; Matsuda, Koichiro K; Kurachi, Kiyotaka K; Funai, Kazuhiro K; Baba, Satoshi S; Iwaizumi, Moriya M

Publication Date: 2022-01-27

Variant appearance in text: EGFR: 2254_2277del; Ser752_Ile759del

PubMed Link: 35087199

Variant Present in the following documents:

• 41598_2022_Article_5589.pdf

View BVdb publication page

---

The immune microenvironment in EGFR- and ERBB2-mutated lung adenocarcinoma.

Esmo Open

Kirchner, M M; Kluck, K K; Brandt, R R; Volckmar, A-L AL; Penzel, R R; Kazdal, D D; Endris, V V; Neumann, O O; Seker-Cin, H H; Goldschmid, H H; Glade, J J; Allgäuer, M M; Kriegsmann, M M; Winter, H H; Muley, T T; Perner, S S; Frost, N N; Reck, M M; Fröhling, S S; Schirmacher, P P; Thomas, M M; Budczies, J J; Christopoulos, P P; Stenzinger, A A

Publication Date: 2021-10

Variant appearance in text: EGFR: Ser752_Ile759del

PubMed Link: 34487971

Variant Present in the following documents:

• mmc1.xlsx, sheet 1

View BVdb publication page

---

Deciphering the immunosuppressive tumor microenvironment in ALK- and EGFR-positive lung adenocarcinoma.

Cancer Immunology, Immunotherapy : Cii

Budczies, Jan J; Kirchner, Martina M; Kluck, Klaus K; Kazdal, Daniel D; Glade, Julia J; Allgäuer, Michael M; Kriegsmann, Mark M; Heußel, Claus-Peter CP; Herth, Felix J FJ; Winter, Hauke H; Meister, Michael M; Muley, Thomas T; Goldmann, Torsten T; Fröhling, Stefan S; Wermke, Martin M; Waller, Cornelius F CF; Tufman, Amanda A; Reck, Martin M; Peters, Solange S; Schirmacher, Peter P; Thomas, Michael M; Christopoulos, Petros P; Stenzinger, Albrecht A

Publication Date: 2021-06-14

Variant appearance in text: EGFR: Ser752_Ile759del

PubMed Link: 34125345

Variant Present in the following documents:

• 262_2021_2981_MOESM1_ESM.pdf

View BVdb publication page

---

Deciphering the immunosuppressive tumor microenvironment in ALK- and EGFR-positive lung adenocarcinoma.

Cancer Immunology, Immunotherapy : Cii

Budczies, Jan J; Kirchner, Martina M; Kluck, Klaus K; Kazdal, Daniel D; Glade, Julia J; Allgäuer, Michael M; Kriegsmann, Mark M; Heußel, Claus-Peter CP; Herth, Felix J FJ; Winter, Hauke H; Meister, Michael M; Muley, Thomas T; Goldmann, Torsten T; Fröhling, Stefan S; Wermke, Martin M; Waller, Cornelius F CF; Tufman, Amanda A; Reck, Martin M; Peters, Solange S; Schirmacher, Peter P; Thomas, Michael M; Christopoulos, Petros P; Stenzinger, Albrecht A

Publication Date: 2022-02

Variant appearance in text: EGFR: Ser752_Ile759del

PubMed Link: 34125345

Variant Present in the following documents:

• 262_2021_2981_MOESM1_ESM.pdf

View BVdb publication page

---

Sensitivity, specificity, and accuracy of a liquid biopsy approach utilizing molecular amplification pools.

Scientific Reports

Garcia, Jessica J; Kamps-Hughes, Nick N; Geiguer, Florence F; Couraud, Sébastien S; Sarver, Brice B; Payen, Léa L; Ionescu-Zanetti, Cristian C

Publication Date: 2021-05-24

Variant appearance in text: EGFR: 2254_2277del; S752_I759del

PubMed Link: 34031447

Variant Present in the following documents:

• 41598_2021_89592_MOESM1_ESM.xlsx, sheet 3

View BVdb publication page

---

Mutation profile and immunoscore signature in thymic carcinomas: An exploratory study and review of the literature.

Thoracic Cancer

Asselta, Rosanna R; Di Tommaso, Luca L; Perrino, Matteo M; Destro, Annarita A; Giordano, Laura L; Cardamone, Giulia G; Rubino, Luca L; Santoro, Armando A; Duga, Stefano S; Zucali, Paolo Andrea PA

Publication Date: 2021-05

Variant appearance in text: EGFR: 2254_2277del; S752_I759del

PubMed Link: 33704917

Variant Present in the following documents:

• TCA-12-1271-s003.xls, sheet 1

View BVdb publication page

---

Pan-cancer circulating tumor DNA detection in over 10,000 Chinese patients.

Nature Communications

Zhang, Yongliang Y; Yao, Yu Y; Xu, Yaping Y; Li, Lifeng L; Gong, Yan Y; Zhang, Kai K; Zhang, Meng M; Guan, Yanfang Y; Chang, Lianpeng L; Xia, Xuefeng X; Li, Lin L; Jia, Shuqin S; Zeng, Qiang Q

Publication Date: 2021-01-04

Variant appearance in text: EGFR: 2254_2277delTCTCCGAAAGCCAACAAGGAAATC; S752_I759del

PubMed Link: 33397889

Variant Present in the following documents:

• 41467_2020_20162_MOESM6_ESM.xlsx, sheet 1

View BVdb publication page

---

Mass Spectrometry as a Highly Sensitive Method for Specific Circulating Tumor DNA Analysis in NSCLC: A Comparison Study.

Cancers

Lamy, Pierre-Jean PJ; van der Leest, Paul P; Lozano, Nicolas N; Becht, Catherine C; Duboeuf, Frédérique F; Groen, Harry J M HJM; Hilgers, Werner W; Pourel, Nicolas N; Rifaela, Naomi N; Schuuring, Ed E; Alix-Panabières, Catherine C

Publication Date: 2020-10-16

Variant appearance in text: EGFR: S752_I759del

PubMed Link: 33081150

Variant Present in the following documents:

• cancers-12-03002-s001.pdf

View BVdb publication page

---

Patient specific circulating tumor DNA fingerprints to monitor treatment response across multiple tumors.

Journal Of Translational Medicine

Li, Jiaping J; Jiang, Wei W; Wei, Jinwang J; Zhang, Jianwei J; Cai, Linbo L; Luo, Minjie M; Wang, Zhan Z; Sun, Wending W; Wang, Shengzhou S; Wang, Chen C; Dai, Chun C; Liu, Jun J; Wang, Guan G; Wang, Jiping J; Xu, Qiang Q; Deng, Yanhong Y

Publication Date: 2020-08-01

Variant appearance in text: EGFR: 2254_2277del; S752_I759del

PubMed Link: 32738923

Variant Present in the following documents:

• 12967_2020_2449_MOESM1_ESM.xlsx, sheet 1

View BVdb publication page

---

EGFR mutation genotypes affect efficacy and resistance mechanisms of osimertinib in T790M-positive NSCLC patients.

Translational Lung Cancer Research

Zheng, Qiufan Q; Huang, Yan Y; Zhao, Hongyun H; Yang, Yunpeng Y; Hong, Shaodong S; Hou, Xue X; Zhao, Yuanyuan Y; Ma, Yuxiang Y; Zhou, Ting T; Zhang, Yaxiong Y; Fang, Wenfeng W; Zhang, Li L

Publication Date: 2020-06

Variant appearance in text: EGFR: S752_I759del

PubMed Link: 32676311

Variant Present in the following documents:

• tlcr-09-03-471.pdf

View BVdb publication page

---

Classification of gastric cancer by EBV status combined with molecular profiling predicts patient prognosis.

Clinical And Translational Medicine

He, Cai-Yun CY; Qiu, Miao-Zhen MZ; Yang, Xin-Hua XH; Zhou, Da-Lei DL; Ma, Jiang-Jun JJ; Long, Ya-Kang YK; Ye, Zu-Lu ZL; Xu, Bo-Heng BH; Zhao, Qi Q; Jin, Ying Y; Lu, Shi-Xun SX; Wang, Zhi-Qiang ZQ; Guan, Wen-Long WL; Zhao, Bai-Wei BW; Zhou, Zhi-Wei ZW; Shao, Jian-Yong JY; Xu, Rui-Hua RH

Publication Date: 2020-01

Variant appearance in text: EGFR: 2254_2277del; Ser752_Ile759del; rs121913463

PubMed Link: 32508039

Variant Present in the following documents:

• CTM2-10-353-s003.xlsx, sheet 3

View BVdb publication page

---

Molecular Characteristics and Clinical Outcomes of EGFR Exon 19 C-Helix Deletion in Non-Small Cell Lung Cancer and Response to EGFR TKIs.

Translational Oncology

Xu, Chun-Wei CW; Lei, Lei L; Wang, Wen-Xian WX; Lin, Li L; Zhu, You-Cai YC; Wang, Hong H; Miao, Li-Yun LY; Wang, Li-Ping LP; Zhuang, Wu W; Fang, Mei-Yu MY; Lv, Tang-Feng TF; Song, Yong Y

Publication Date: 2020-09

Variant appearance in text: EGFR: S752_I759del

PubMed Link: 32492620

Variant Present in the following documents:

• Main text
• main.pdf

View BVdb publication page

---

Differential significance of molecular subtypes which were classified into EGFR exon 19 deletion on the first line afatinib monotherapy.

Bmc Cancer

Tokudome, Nahomi N; Koh, Yasuhiro Y; Akamatsu, Hiroaki H; Fujimoto, Daichi D; Okamoto, Isamu I; Nakagawa, Kazuhiko K; Hida, Toyoaki T; Imamura, Fumio F; Morita, Satoshi S; Yamamoto, Nobuyuki N

Publication Date: 2020-02-06

Variant appearance in text: EGFR: S752_I759del

PubMed Link: 32028909

Variant Present in the following documents:

• Main text

View BVdb publication page

---

EGFR T790M detection rate in lung adenocarcinomas at baseline using droplet digital PCR and validation by ultra-deep next generation sequencing.

Translational Lung Cancer Research

Lettig, Lucio L; Sahnane, Nora N; Pepe, Francesco F; Cerutti, Roberta R; Albeni, Chiara C; Franzi, Francesca F; Veronesi, Giovanni G; Ogliari, Francesca F; Pastore, Alessia A; Tuzi, Alessandro A; Pinotti, Graziella G; Bovio, Antonella A; Verusio, Claudio C; Giordano, Monica M; Troncone, Giancarlo G; Sessa, Fausto F; Malapelle, Umberto U; Furlan, Daniela D

Publication Date: 2019-10

Variant appearance in text: EGFR: S752_I759del

PubMed Link: 31737495

Variant Present in the following documents:

• Main text

View BVdb publication page

---

Validation and Clinical Applications of a Comprehensive Next Generation Sequencing System for Molecular Characterization of Solid Cancer Tissues.

Frontiers In Molecular Biosciences

Dehghani, Mehdi M; Rosenblatt, Kevin P KP; Li, Lei L; Rakhade, Mrudula M; Amato, Robert J RJ

Publication Date: 2019

Variant appearance in text: EGFR: S752_I759del

PubMed Link: 31681791

Variant Present in the following documents:

• Main text
• fmolb-06-00082.pdf
• Data_Sheet_8.xlsx, sheet 1

View BVdb publication page

---

Oncogenic driver mutations in Swiss never smoker patients with lung adenocarcinoma and correlation with clinicopathologic characteristics and outcome.

Plos One

Grosse, Claudia C; Soltermann, Alex A; Rechsteiner, Markus M; Grosse, Alexandra A

Publication Date: 2019

Variant appearance in text: EGFR: 2254_2277del; S752_I759del

PubMed Link: 31386689

Variant Present in the following documents:

• Main text
• pone.0220691.pdf

View BVdb publication page

---

Mutational profile of Brazilian lung adenocarcinoma unveils association of EGFR mutations with high Asian ancestry and independent prognostic role of KRAS mutations.

Scientific Reports

Leal, Letícia Ferro LF; de Paula, Flávia Escremim FE; De Marchi, Pedro P; de Souza Viana, Luciano L; Pinto, Gustavo Dix Junqueira GDJ; Carlos, Carolina Dias CD; Berardinelli, Gustavo Noriz GN; Miziara, José Elias JE; da Silva, Carlos Maciel CM; Silva, Eduardo Caetano Albino ECA; Pereira, Rui R; de Oliveira, Marco Antonio MA; Scapulatempo-Neto, Cristovam C; Reis, Rui Manuel RM

Publication Date: 2019-03-01

Variant appearance in text: EGFR: Ser752_Ile759del

PubMed Link: 30824880

Variant Present in the following documents:

• Main text

View BVdb publication page

---

Analysis of the frequency of oncogenic driver mutations and correlation with clinicopathological characteristics in patients with lung adenocarcinoma from Northeastern Switzerland.

Diagnostic Pathology

Grosse, Alexandra A; Grosse, Claudia C; Rechsteiner, Markus M; Soltermann, Alex A

Publication Date: 2019-02-11

Variant appearance in text: EGFR: 2254_2277del; S752_I759del

PubMed Link: 30744664

Variant Present in the following documents:

• Main text
• 13000_2019_Article_789.pdf

View BVdb publication page

---

Feasibility and utility of a panel testing for 114 cancer-associated genes in a clinical setting: A hospital-based study.

Cancer Science

Sunami, Kuniko K; Ichikawa, Hitoshi H; Kubo, Takashi T; Kato, Mamoru M; Fujiwara, Yutaka Y; Shimomura, Akihiko A; Koyama, Takafumi T; Kakishima, Hiroki H; Kitami, Mayuko M; Matsushita, Hiromichi H; Furukawa, Eisaku E; Narushima, Daichi D; Nagai, Momoko M; Taniguchi, Hirokazu H; Motoi, Noriko N; Sekine, Shigeki S; Maeshima, Akiko A; Mori, Taisuke T; Watanabe, Reiko R; Yoshida, Masayuki M; Yoshida, Akihiko A; Yoshida, Hiroshi H; Satomi, Kaishi K; Sukeda, Aoi A; Hashimoto, Taiki T; Shimizu, Toshio T; Iwasa, Satoru S; Yonemori, Kan K; Kato, Ken K; Morizane, Chigusa C; Ogawa, Chitose C; Tanabe, Noriko N; Sugano, Kokichi K; Hiraoka, Nobuyoshi N; Tamura, Kenji K; Yoshida, Teruhiko T; Fujiwara, Yasuhiro Y; Ochiai, Atsushi A; Yamamoto, Noboru N; Kohno, Takashi T

Publication Date: 2019-04

Variant appearance in text: EGFR: S752_I759del

PubMed Link: 30742731

Variant Present in the following documents:

• Main text
• CAS-110-1480-s003.xlsx, sheet 3

View BVdb publication page

---

Fibroblast growth factor receptor 3 (FGFR3) aberrations in muscle-invasive urothelial carcinoma.

Bmc Urology

Kim, Young Saing YS; Kim, Kyung K; Kwon, Ghee-Young GY; Lee, Su Jin SJ; Park, Se Hoon SH

Publication Date: 2018-07-31

Variant appearance in text: EGFR: 2254_2277del; S752_I759del

PubMed Link: 30064409

Variant Present in the following documents:

• 12894_2018_380_MOESM1_ESM.xlsx, sheet 1

View BVdb publication page

---

Lung cancer in never smokers from the Princess Margaret Cancer Centre.

Oncotarget

Korpanty, Grzegorz J GJ; Kamel-Reid, Suzanne S; Pintilie, Melania M; Hwang, David M DM; Zer, Alona A; Liu, Geoffrey G; Leighl, Natasha B NB; Feld, Ronald R; Siu, Lillian L LL; Bedard, Philippe L PL; Tsao, Ming-Sound MS; Shepherd, Frances A FA

Publication Date: 2018-04-27

Variant appearance in text: EGFR: Ser752_Ile759del

PubMed Link: 29854298

Variant Present in the following documents:

• oncotarget-09-22559-s001.pdf

View BVdb publication page

---

Feasibility study of cancer genome alterations identified by next generation sequencing: ABC study.

Japanese Journal Of Clinical Oncology

Naito, Yoichi Y; Takahashi, Hideaki H; Shitara, Kohei K; Okamoto, Wataru W; Bando, Hideaki H; Kuwata, Takeshi T; Kuboki, Yasutoshi Y; Matsumoto, Shingo S; Miki, Izumi I; Yamanaka, Takeharu T; Watanabe, Atsushi A; Kojima, Motohiro M

Publication Date: 2018-06-01

Variant appearance in text: EGFR: 2254_2277del; S752_I759del

PubMed Link: 29659903

Variant Present in the following documents:

• hyy052supplementaltable1ionver1.xls, sheet 1

View BVdb publication page

---

Molecular characteristics and clinical outcomes of EGFR exon 19 indel subtypes to EGFR TKIs in NSCLC patients.

Oncotarget

Su, Jian J; Zhong, Wenzhao W; Zhang, Xuchao X; Huang, Ying Y; Yan, Honghong H; Yang, Jinji J; Dong, Zhongyi Z; Xie, Zhi Z; Zhou, Qing Q; Huang, Xiaosui X; Lu, Danxia D; Yan, Wenqing W; Wu, Yi-Long YL

Publication Date: 2017-12-19

Variant appearance in text: EGFR: 2254_2277del

PubMed Link: 29340050

Variant Present in the following documents:

• Main text
• oncotarget-08-111246-s001.pdf
• oncotarget-08-111246.pdf

View BVdb publication page

---

Molecular Characterization of Urothelial Carcinoma of the Bladder and Upper Urinary Tract.

Translational Oncology

Lee, Ji Yun JY; Kim, Kyung K; Sung, Hyun Hwan HH; Jeon, Hwang Gyun HG; Jeong, Byong Chang BC; Seo, Seong Il SI; Jeon, Seong Soo SS; Lee, Hyun Moo HM; Choi, Han-Yong HY; Kwon, Ghee-Young GY; Kim, Kyoung-Mee KM; Lee, Jeeyun J; Lim, Ho Yeong HY; Park, Se Hoon SH

Publication Date: 2018-02

Variant appearance in text: EGFR: 2254_2277del; S752_I759del

PubMed Link: 29161613

Variant Present in the following documents:

• mmc1.xlsx, sheet 1

View BVdb publication page

---

Evaluation of pre-analytical conditions and comparison of the performance of several digital PCR assays for the detection of major EGFR mutations in circulating DNA from non-small cell lung cancers: the CIRCAN_0 study.

Oncotarget

Garcia, Jessica J; Dusserre, Eric E; Cheynet, Valérie V; Bringuier, Pierre Paul PP; Brengle-Pesce, Karen K; Wozny, Anne-Sophie AS; Rodriguez-Lafrasse, Claire C; Freyer, Gilles G; Brevet, Marie M; Payen, Léa L; Couraud, Sébastien S

Publication Date: 2017-10-20

Variant appearance in text: EGFR: S752_I759del

PubMed Link: 29152135

Variant Present in the following documents:

• Main text

View BVdb publication page

---

Circulating tumour DNA sequence analysis as an alternative to multiple myeloma bone marrow aspirates.

Nature Communications

Kis, Olena O; Kaedbey, Rayan R; Chow, Signy S; Danesh, Arnavaz A; Dowar, Mark M; Li, Tiantian T; Li, Zhihua Z; Liu, Jessica J; Mansour, Mark M; Masih-Khan, Esther E; Zhang, Tong T; Bratman, Scott V SV; Oza, Amit M AM; Kamel-Reid, Suzanne S; Trudel, Suzanne S; Pugh, Trevor J TJ

Publication Date: 2017-05-11

Variant appearance in text: EGFR: S752_I759del; rs121913463

PubMed Link: 28492226

Variant Present in the following documents:

• ncomms15086-s3.xlsx, sheet 1

View BVdb publication page

---

Mutational profiling of brain metastasis from breast cancer: matched pair analysis of targeted sequencing between brain metastasis and primary breast cancer.

Oncotarget

Lee, Ji Yun JY; Park, Kyunghee K; Lim, Sung Hee SH; Kim, Hae Su HS; Yoo, Kwai Han KH; Jung, Ki Sun KS; Song, Haa-Na HN; Hong, Mineui M; Do, In-Gu IG; Ahn, TaeJin T; Lee, Se Kyung SK; Bae, Soo Youn SY; Kim, Seok Won SW; Lee, Jeong Eon JE; Nam, Seok Jin SJ; Kim, Duk-Hwan DH; Jung, Hae Hyun HH; Kim, Ji-Yeon JY; Ahn, Jin Seok JS; Im, Young-Hyuck YH; Park, Yeon Hee YH

Publication Date: 2015-12-22

Variant appearance in text: EGFR: 2254_2277del; S752_I759del

PubMed Link: 26527317

Variant Present in the following documents:

• oncotarget-06-43731-s002.xlsx, sheet 1

View BVdb publication page

---

Patient-derived cell models as preclinical tools for genome-directed targeted therapy.

Oncotarget

Lee, Ji Yun JY; Kim, Sun Young SY; Park, Charny C; Kim, Nayoung K D NK; Jang, Jiryeon J; Park, Kyunghee K; Yi, Jun Ho JH; Hong, Mineui M; Ahn, Taejin T; Rath, Oliver O; Schueler, Julia J; Kim, Seung Tae ST; Do, In-Gu IG; Lee, Sujin S; Park, Se Hoon SH; Ji, Yong Ick YI; Kim, Dukwhan D; Park, Joon Oh JO; Park, Young Suk YS; Kang, Won Ki WK; Kim, Kyoung-Mee KM; Park, Woong-Yang WY; Lim, Ho Yeong HY; Lee, Jeeyun J

Publication Date: 2015-09-22

Variant appearance in text: EGFR: 2254_2277del; S752_I759del

PubMed Link: 26296973

Variant Present in the following documents:

• oncotarget-06-25619-s003.xls, sheet 1

View BVdb publication page

---

The mutation rates of EGFR in non-small cell lung cancer and KRAS in colorectal cancer of Chinese patients as detected by pyrosequencing using a novel dispensation order.

Journal Of Experimental & Clinical Cancer Research : Cr

Xie, Guohua G; Xie, Fang F; Wu, Ping P; Yuan, Xiangliang X; Ma, Yanhui Y; Xu, Yunchuan Y; Li, Li L; Xu, Ling L; Yang, Ming M; Shen, Lisong L

Publication Date: 2015-06-18

Variant appearance in text: EGFR: 2254_2277del

PubMed Link: 26081767

Variant Present in the following documents:

• Main text
• 13046_2015_Article_179.pdf

View BVdb publication page

---

Molecular characterization of patients with pathologic complete response or early failure after neoadjuvant chemotherapy for locally advanced breast cancer using next generation sequencing and nCounter assay.

Oncotarget

Park, Kyunghee K; Choi, Moon Ki MK; Jung, Hae Hyun HH; Do, In-Gu IG; Lee, Kwang Hee KH; Ahn, TaeJin T; Kil, Won Ho WH; Kim, Seok Won SW; Lee, Jeong Eon JE; Nam, Seok Jin SJ; Kim, Duk-Hwan DH; Ahn, Jin Seok JS; Im, Young-Hyuck YH; Park, Yeon Hee YH

Publication Date: 2015-09-15

Variant appearance in text: EGFR: 2254_2277del; S752_I759del

PubMed Link: 26009992

Variant Present in the following documents:

• oncotarget-06-24499-s002.xlsx, sheet 1

View BVdb publication page

---

High-throughput sequencing and copy number variation detection using formalin fixed embedded tissue in metastatic gastric cancer.

Plos One

Kim, Seokhwi S; Lee, Jeeyun J; Hong, Min Eui ME; Do, In-Gu IG; Kang, So Young SY; Ha, Sang Yun SY; Kim, Seung Tae ST; Park, Se Hoon SH; Kang, Won Ki WK; Choi, Min-Gew MG; Lee, Jun Ho JH; Sohn, Tae Sung TS; Bae, Jae Moon JM; Kim, Sung S; Kim, Duk-Hwan DH; Kim, Kyoung-Mee KM

Publication Date: 2014

Variant appearance in text: EGFR: 2254_2277del; S752_I759del

PubMed Link: 25372287

Variant Present in the following documents:

• pone.0111693.s003.xls, sheet 1

View BVdb publication page

---

Identification of candidate genes for lung cancer somatic mutation test kits.

Genetics And Molecular Biology

Chen, Yong Y; Shi, Jian-Xin JX; Pan, Xu-Feng XF; Feng, Jian J; Zhao, Heng H

Publication Date: 2013-09

Variant appearance in text: EGFR: 2254_2277del

PubMed Link: 24130455

Variant Present in the following documents:

• Main text
• 2013-011.pdf

View BVdb publication page

---

The Cancer Cell Line Encyclopedia enables predictive modelling of anticancer drug sensitivity.

Nature

Barretina, Jordi J; Caponigro, Giordano G; Stransky, Nicolas N; Venkatesan, Kavitha K; Margolin, Adam A AA; Kim, Sungjoon S; Wilson, Christopher J CJ; Lehár, Joseph J; Kryukov, Gregory V GV; Sonkin, Dmitriy D; Reddy, Anupama A; Liu, Manway M; Murray, Lauren L; Berger, Michael F MF; Monahan, John E JE; Morais, Paula P; Meltzer, Jodi J; Korejwa, Adam A; Jané-Valbuena, Judit J; Mapa, Felipa A FA; Thibault, Joseph J; Bric-Furlong, Eva E; Raman, Pichai P; Shipway, Aaron A; Engels, Ingo H IH; Cheng, Jill J; Yu, Guoying K GK; Yu, Jianjun J; Aspesi, Peter P; de Silva, Melanie M; Jagtap, Kalpana K; Jones, Michael D MD; Wang, Li L; Hatton, Charles C; Palescandolo, Emanuele E; Gupta, Supriya S; Mahan, Scott S; Sougnez, Carrie C; Onofrio, Robert C RC; Liefeld, Ted T; MacConaill, Laura L; Winckler, Wendy W; Reich, Michael M; Li, Nanxin N; Mesirov, Jill P JP; Gabriel, Stacey B SB; Getz, Gad G; Ardlie, Kristin K; Chan, Vivien V; Myer, Vic E VE; Weber, Barbara L BL; Porter, Jeff J; Warmuth, Markus M; Finan, Peter P; Harris, Jennifer L JL; Meyerson, Matthew M; Golub, Todd R TR; Morrissey, Michael P MP; Sellers, William R WR; Schlegel, Robert R; Garraway, Levi A LA

Publication Date: 2012-03-28

Variant appearance in text: EGFR: 2254_2277delTCTCCGAAAGCCAACAAGGAAATC

PubMed Link: 22460905

Variant Present in the following documents:

• NIHMS361223-supplement-4.xlsx, sheet 3

View BVdb publication page

---