NOTCH1 c.916_937del ;(p.C306Tfs*318)

Variant ID: 9-139413204-TGGCAGGTCCCGCCGTTCTGGCA-T

NM_017617.3(NOTCH1):c.916_937del;(p.C306Tfs*318)

This variant was identified in 1 publication

View GRCh38 version.




Publications:


Genomic clonal evolution correlated with phenotype and prognosis in gastric cancer.

Clinical And Translational Medicine
Ge, Jie J; Li, Xuan X; Deng, Zhenghao Z; Gao, Xuan X; Liu, Yaoyao Y; Xiong, Xingui X; Zhao, Xianhui X; Peng, Huan H; Yi, Xin X; Xia, Xuefeng X; Chen, Zihua Z; Li, Lifeng L; Zhou, Haiyan H; Liu, Heli H
Publication Date: 2022-04

Variant appearance in text: NOTCH1: 916_937delTGCCAGAACGGCGGGACCTGCC; C306Tfs*318
PubMed Link: 35384329
Variant Present in the following documents:
  • CTM2-12-e799-s006.xlsx, sheet 2
View BVdb publication page