KIT c.1652_1672del ;(p.P551_K558delinsQ)

Variant ID: 4-55593586-CCCATGTATGAAGTACAGTGGA-C

NM_000222.2(KIT):c.1652_1672del;(p.P551_K558delinsQ)

This variant was identified in 2 publications

View GRCh38 version.




Publications:


Mutational spectrum and classification of novel mutations in patients with metastatic gastrointestinal stromal tumours.

International Journal Of Oncology
Bombac, Alenka A; Zakotnik, Branko B; Bucic, Marina M; Setrajcic Dragos, Vita V; Gazic, Barbara B; Stegel, Vida V; Klancar, Gasper G; Novakovic, Srdjan S
Publication Date: 2020-06

Variant appearance in text: KIT: 1652_1672del
PubMed Link: 32236636
Variant Present in the following documents:
  • Main text
  • Supplementary_Data.pdf
  • ijo-56-06-1468.pdf
View BVdb publication page



Driver gene alterations and activated signaling pathways toward malignant progression of gastrointestinal stromal tumors.

Cancer Science
Ohshima, Keiichi K; Fujiya, Keiichi K; Nagashima, Takeshi T; Ohnami, Sumiko S; Hatakeyama, Keiichi K; Urakami, Kenichi K; Naruoka, Akane A; Watanabe, Yuko Y; Moromizato, Sachi S; Shimoda, Yuji Y; Ohnami, Shumpei S; Serizawa, Masakuni M; Akiyama, Yasuto Y; Kusuhara, Masatoshi M; Mochizuki, Tohru T; Sugino, Takashi T; Shiomi, Akio A; Tsubosa, Yasuhiro Y; Uesaka, Katsuhiko K; Terashima, Masanori M; Yamaguchi, Ken K
Publication Date: 2019-12

Variant appearance in text: KIT: 1652_1672delCCATGTATGAAGTACAGTGGA; P551_K558delinsQ
PubMed Link: 31553483
Variant Present in the following documents:
  • CAS-110-3821-s008.xlsx, sheet 1
  • CAS-110-3821-s009.xlsx, sheet 1
View BVdb publication page