Publications:

Comprehensive Genomic Profiling of Rare Tumors: Routes to Targeted Therapies.

Frontiers In Oncology

Wang, Shuhang S; Chen, Rongrong R; Tang, Yu Y; Yu, Yue Y; Fang, Yuan Y; Huang, Huiyao H; Wu, Dawei D; Fang, Hong H; Bai, Ying Y; Sun, Chao C; Yu, Anqi A; Fan, Qi Q; Gu, Dejian D; Yi, Xin X; Li, Ning N

Publication Date: 2020

Variant appearance in text: KIT: 1654_1674delATGTATGAAGTACAGTGGAAG; M552_K558del

PubMed Link: 32373528

Variant Present in the following documents:

• Table_6.xlsx, sheet 1

View BVdb publication page

Unraveling the spectrum of KIT mutations in gastrointestinal stromal tumors: An Indian Tertiary Cancer Center Experience.

South Asian Journal Of Cancer

Pai, Trupti T; Bal, Munita M; Shetty, Omshree O; Gurav, Mamta M; Ostwal, Vikas V; Ramaswamy, Anant A; Ramadwar, Mukta M; Desai, Sangeeta S

Publication Date: 2017

Variant appearance in text: CD117: M552_K558del

PubMed Link: 28975118

Variant Present in the following documents:

• Main text
• SAJC-6-113.pdf

View BVdb publication page

Massively parallel sequencing fails to detect minor resistant subclones in tissue samples prior to tyrosine kinase inhibitor therapy.

Bmc Cancer

Heydt, Carina C; Kumm, Niklas N; Fassunke, Jana J; Künstlinger, Helen H; Ihle, Michaela Angelika MA; Scheel, Andreas A; Schildhaus, Hans-Ulrich HU; Haller, Florian F; Büttner, Reinhard R; Odenthal, Margarete M; Wardelmann, Eva E; Merkelbach-Bruse, Sabine S

Publication Date: 2015-04-15

Variant appearance in text: KIT: M552_K558del

PubMed Link: 25886408

Variant Present in the following documents:

• Main text
• 12885_2015_Article_1311.pdf

View BVdb publication page